Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-130a-3p URS0000315338_10116

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGUGCAAUGUUAAAAGGGCAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 40 other species

  1. Alligator mississippiensis (American alligator) Ami-Mir-130-P1b_3p (mature (guide))
  2. Anolis carolinensis Aca-Mir-130-P1b_3p (mature (guide))
  3. Bos taurus bta-miR-130a
  4. Canis lupus familiaris (dog) cfa-miR-130a
  5. Capra hircus miR-130a
  6. Cavia porcellus cpo-miR-130a-3p
  7. Cervus elaphus cel-miR-130a
  8. Chrysemys picta bellii Cpi-Mir-130-P1b_3p (mature (guide))
  9. Columba livia (rock pigeon) cli-miR-130a-3p
  10. Cricetulus griseus (Chinese hamster) cgr-miR-130a-3p
  11. Cyprinus carpio (common carp) ccr-miR-130a
  12. Danio rerio dre-miR-130a
  13. Dasypus novemcinctus dno-miR-130a-3p
  14. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-130-P1c_3p (mature (guide))
  15. Equus caballus (horse) eca-miR-130a
  16. Gallus gallus gga-miR-130c-3p
  17. Gekko japonicus Gja-Mir-130-P1b_3p (mature (guide))
  18. Homo sapiens (human) hsa-miR-130a-3p
  19. Latimeria chalumnae (coelacanth) Lch-Mir-130-P1b_3p (mature (guide))
  20. Lepisosteus oculatus (spotted gar) Loc-Mir-130-P1b_3p (mature (co-guide))
  21. Macaca mulatta (Rhesus monkey) Mml-Mir-130-P1c_3p (mature (guide))
  22. Microcaecilia unicolor Mun-Mir-130-P1b_3p (mature (guide))
  23. Monodelphis domestica mdo-miR-130c-3p
  24. Mus musculus (house mouse) mmu-miR-130a-3p
  25. Ophiophagus hannah (king cobra) oha-miR-130b-3p
  26. Ornithorhynchus anatinus (platypus) oan-miR-130b-3p
  27. Otolemur garnettii oga-miR-130a
  28. Ovis aries (sheep) miscellaneous RNA
  29. Pan troglodytes ptr-miR-130a
  30. Pongo pygmaeus ppy-miR-130a
  31. Pteropus alecto (black flying fox) pal-miR-130-3p
  32. Python bivittatus (Burmese python) pbv-miR-130d-3p
  33. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-130-P1b_3p (mature (guide))
  34. Sphenodon punctatus (tuatara) Spt-Mir-130-P1b_3p (mature (guide))
  35. Sus scrofa (pig) ssc-miR-130a
  36. Taeniopygia guttata (zebra finch) tgu-miR-130c-3p
  37. Tor tambroides miR-130a
  38. Tupaia chinensis (Chinese tree shrew) tch-miR-130a-3p
  39. Xenopus laevis Xla-Mir-130-P1b3_3p (mature (guide))
  40. Xenopus tropicalis xtr-miR-130a
Publications