Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Apis mellifera (honey bee) ame-miR-14-3p URS0000300EB0_7460

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCAGUCUUUUUCUCUCUCCUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Anopheles gambiae aga-miR-14
  2. Bombyx mori (domestic silkworm) bmo-miR-14-3p
  3. Drosophila ananassae dan-miR-14
  4. Drosophila erecta der-miR-14
  5. Drosophila grimshawi dgr-miR-14
  6. Drosophila melanogaster (fruit fly) Drosophila_melanogaster piRNA piR-dme-33959
  7. Drosophila mojavensis dmo-miR-14
  8. Drosophila persimilis dpe-miR-14
  9. Drosophila pseudoobscura dps-miR-14
  10. Drosophila pseudoobscura pseudoobscura (Fruit fly) miRNA FBtr0294439_df_nrg
  11. Drosophila sechellia dse-miR-14
  12. Drosophila simulans dsi-miR-14
  13. Drosophila virilis dvi-miR-14-3p
  14. Drosophila willistoni dwi-miR-14
  15. Drosophila yakuba dya-miR-14
  16. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-50659408
  17. Nasonia giraulti ngi-miR-14
  18. Nasonia vitripennis nvi-miR-14
Publications