Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Anopheles gambiae (African malaria mosquito) aga-miR-14 URS0000300EB0_7165

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

aga-mir-14: aga-mir-14 is a microRNA that was selected for functional study based on its predicted targeting of multiple immune genes and its identification as the most abundant miRNA candidate using the CLEAR-CLIP approach [PMC7202664]. Depletion of aga-mir-14 was found to result in the suppression of both parasite species and the microbiota, indicating its role in regulating diverse immune genes and modulating broad-spectrum defenses [PMC7202664]. Specifically, depletion of aga-mir-14 led to a significant increase in the mRNA abundance of Tep1, a key anti-Plasmodium factor, in mosquito midguts [PMC7202664]. While hundreds of genes were regulated upon depletion of aga-mir-14 or aga-miR-305, only a few contained potential binding sites for these miRNAs [PMC7202664]. The sponge for aga-mir-14 was predicted using miRNAsong by introducing mismatches at specific positions [PMC7202664]. Conditional depletion of aga-mir-14 resulted in suppression of both P. falciparum and P. berghei infections, as well as midgut microbiota [PMC7202664]. Additionally, a novel miRNA called aae-mir-143 with a seed sequence match to aga-mir-14 was identified as highly expressed [PMC4303268]. Depletion of both aga-mir-14 and aga-miR305 increased mosquito resistance to P. berghei and P. falciparum infections by enhancing the expression of multiple immunity-related and anti-plasmodium genes [PMC8716737]. Overall, these findings highlight the role of miRNAs such as aga-miR8, aga-miR305, and particularly aga-mir14 in regulating mosquito immunity against parasite infections [PMC8716737].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCAGUCUUUUUCUCUCUCCUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Apis mellifera ame-miR-14-3p
  2. Bombyx mori (domestic silkworm) bmo-miR-14-3p
  3. Drosophila ananassae dan-miR-14
  4. Drosophila erecta der-miR-14
  5. Drosophila grimshawi dgr-miR-14
  6. Drosophila melanogaster (fruit fly) Drosophila_melanogaster piRNA piR-dme-33959
  7. Drosophila mojavensis dmo-miR-14
  8. Drosophila persimilis dpe-miR-14
  9. Drosophila pseudoobscura dps-miR-14
  10. Drosophila pseudoobscura pseudoobscura (Fruit fly) miRNA FBtr0294439_df_nrg
  11. Drosophila sechellia dse-miR-14
  12. Drosophila simulans dsi-miR-14
  13. Drosophila virilis dvi-miR-14-3p
  14. Drosophila willistoni dwi-miR-14
  15. Drosophila yakuba dya-miR-14
  16. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-50659408
  17. Nasonia giraulti ngi-miR-14
  18. Nasonia vitripennis nvi-miR-14
Publications