Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bombyx mori (domestic silkworm) bmo-miR-14-3p URS0000300EB0_7091

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bmo-mir-14: Bmo-mir-14 is a miRNA that has been studied in the context of the interaction between silkworm and BmCPV. It has been found that the expression level of bmo-mir-14 is down-regulated in the infected midgut at 72 h post inoculation, suggesting its potential role in this interaction [PMC3699532]. In a study using qRT-PCR, bmo-mir-14 was validated as one of the down-regulated miRNAs [PMC3699532]. However, contrary results were found for bmo-mir-14 in terms of its expression levels when compared to literature-based collections [PMC4045974]. Bmo-mir-14 has been shown to have a synchronized expression pattern with bmo-miR-10 and they share common targets such as ecdysone receptor (EcR), orphan nuclear receptor (E75), BmCF1, and Jhe [PMC2500172]. Additionally, bmo-miR-278 has been found to have a relatively high expression level and may play a similar role as bmo-miR-10 and bmo-mir-14 in regulating energy metabolism at molting stage [PMC2500172]. Bmo-mir-14 was also strongly expressed in all developmental stages (larva, pupa, and moth) [PMC2435238]. In terms of experimental techniques, methylated DNA probes were used to improve signal strength for detecting bmo-mir-14 on Northern blots [PMC2435238]. Furthermore, over-expression of bmo-miR-9a, bmo-mir-14, and bmo-miR2766 resulted in a significant decrease in the relative expression of the reporter gene Renilla luciferase [PMC3535529].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCAGUCUUUUUCUCUCUCCUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Anopheles gambiae aga-miR-14
  2. Apis mellifera ame-miR-14-3p
  3. Drosophila ananassae dan-miR-14
  4. Drosophila erecta der-miR-14
  5. Drosophila grimshawi dgr-miR-14
  6. Drosophila melanogaster (fruit fly) Drosophila_melanogaster piRNA piR-dme-33959
  7. Drosophila mojavensis dmo-miR-14
  8. Drosophila persimilis dpe-miR-14
  9. Drosophila pseudoobscura dps-miR-14
  10. Drosophila pseudoobscura pseudoobscura (Fruit fly) miRNA FBtr0294439_df_nrg
  11. Drosophila sechellia dse-miR-14
  12. Drosophila simulans dsi-miR-14
  13. Drosophila virilis dvi-miR-14-3p
  14. Drosophila willistoni dwi-miR-14
  15. Drosophila yakuba dya-miR-14
  16. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-50659408
  17. Nasonia giraulti ngi-miR-14
  18. Nasonia vitripennis nvi-miR-14
Publications