Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-202 URS00002DA4FF_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-202: Bta-mir-202 is a microRNA that has been found to be significantly increased at 8 hours [PMC9260119]. It has been shown to prevent the apoptosis of LPS-induced bMECs [PMC9260119]. Bta-mir-202 is only expressed in the testis and ovary of cattle [PMC5053184]. It is one of the 13 differentially expressed miRNAs that regulate a total of 182 differentially expressed genes [PMC7911131]. In bovine growth and atresia follicles, bta-mir-202 is upregulated in large healthy follicles compared to small follicles and plays a functional role in follicular atresia [PMC10080932]. Bta-mir-202, along with other miRNAs, has differential expression patterns in stem-loop RT-qPCR results compared to RNA-Seq results [PMC4840452]. It is upregulated in large healthy follicles and targets signaling pathways involved in follicular cell proliferation and steroid generation [PMC8316591]. Bta-mir-202 is exclusively expressed in the gonads and may regulate the viability of mural follicles [PMC5736867]. In the bovine corpus luteum (CL), bta-mir-202 peaks during early CL development but decreases in subsequent CL classes, with low expression levels in regressing CL [PMC5736867]. The role of bta-mir-202 in the bovine CL is not fully understood but it may be involved in blocking cell proliferation, invasion, or apoptosis during early CL development [PMC5736867].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCCUAUGCAUAUACUUCUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 23 other species

Publications