Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Macaca mulatta (Rhesus monkey) Mml-Mir-202_5p (mature (guide)) URS00002DA4FF_9544

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCCUAUGCAUAUACUUCUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 23 other species

  1. Alligator mississippiensis Ami-Mir-202_5p (mature (guide))
  2. Anolis carolinensis Aca-Mir-202_5p (mature (guide))
  3. Bos taurus bta-miR-202
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-202
  5. Canis lupus familiaris Cfa-Mir-202_5p (mature (guide))
  6. Capra hircus chi-miR-202-5p
  7. Cavia porcellus cpo-miR-202-5p
  8. Chrysemys picta bellii Cpi-Mir-202_5p (mature (guide))
  9. Columba livia cli-miR-202-5p
  10. Cricetulus griseus cgr-miR-202
  11. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-202_5p (mature (guide))
  12. Gallus gallus Gga-Mir-202_5p (mature (guide))
  13. Gekko japonicus Gja-Mir-202_5p (mature (guide))
  14. Homo sapiens Hsa-Mir-202_5p (mature (guide))
  15. Mus musculus mmu-miR-202-5p
  16. Ornithorhynchus anatinus (platypus) Oan-Mir-202_5p (mature (guide))
  17. Oryctolagus cuniculus Ocu-Mir-202_5p (mature (guide))
  18. Pteropus alecto pal-miR-202-5p
  19. Rattus norvegicus Rno-Mir-202_5p (mature (guide))
  20. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-202_5p (mature (guide))
  21. Sphenodon punctatus Spt-Mir-202_5p (mature (guide))
  22. Sus scrofa ssc-miR-202-5p
  23. Taeniopygia guttata Tgu-Mir-202_5p (mature (guide))