Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Callithrix jacchus (white-tufted-ear marmoset) cja-miR-202 URS00002DA4FF_9483

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCCUAUGCAUAUACUUCUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 23 other species

  1. Alligator mississippiensis Ami-Mir-202_5p (mature (guide))
  2. Anolis carolinensis Aca-Mir-202_5p (mature (guide))
  3. Bos taurus bta-miR-202
  4. Canis lupus familiaris Cfa-Mir-202_5p (mature (guide))
  5. Capra hircus chi-miR-202-5p
  6. Cavia porcellus cpo-miR-202-5p
  7. Chrysemys picta bellii Cpi-Mir-202_5p (mature (guide))
  8. Columba livia cli-miR-202-5p
  9. Cricetulus griseus cgr-miR-202
  10. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-202_5p (mature (guide))
  11. Gallus gallus Gga-Mir-202_5p (mature (guide))
  12. Gekko japonicus Gja-Mir-202_5p (mature (guide))
  13. Homo sapiens Hsa-Mir-202_5p (mature (guide))
  14. Macaca mulatta (Rhesus monkey) Mml-Mir-202_5p (mature (guide))
  15. Mus musculus mmu-miR-202-5p
  16. Ornithorhynchus anatinus (platypus) Oan-Mir-202_5p (mature (guide))
  17. Oryctolagus cuniculus Ocu-Mir-202_5p (mature (guide))
  18. Pteropus alecto pal-miR-202-5p
  19. Rattus norvegicus Rno-Mir-202_5p (mature (guide))
  20. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-202_5p (mature (guide))
  21. Sphenodon punctatus Spt-Mir-202_5p (mature (guide))
  22. Sus scrofa ssc-miR-202-5p
  23. Taeniopygia guttata Tgu-Mir-202_5p (mature (guide))