Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-214 URS00002C11C3_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-214: Bta-mir-214 is a microRNA that has been identified in various studies to be differentially expressed in different biological contexts. It has been found to be highly enriched in the follicular fluid of subordinate follicles compared to dominant follicles [PMC4438052]. Bta-mir-214, along with other miRNAs, has also been identified as a regulator of inflammation in bovine mammary epithelial cells [PMC5821052]. It is expressed at a higher level in the fetal bovine ovary compared to somatic tissue pools [PMC4522283]. Bta-mir-214 has been implicated in regulating the NF-kappa B signaling pathway [PMC6600136]. Additionally, it has been found to be enriched in the secretory fluid of the estrous cycle at day 3 but repressed at day 7 compared to dominant follicle groups [PMC4156418]. Bta-mir-214 is also differentially expressed during lactation, with higher expression levels observed during late lactation compared to peak lactation [PMC3498112]. It targets various genes, including IRF1, and is predicted to regulate multiple target genes [PMC7554596] [PMC3596360]. Furthermore, bta-mir-214 is part of a miRNA-mRNA network that regulates key signal transduction pathways associated with energy homeostasis and immune response in transition dairy cows [PMC9445238]. However, its specific role and targets are still not fully understood.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACAGCAGGCACAGACAGGCAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 38 other species

  1. Alligator mississippiensis Ami-Mir-214-v1_3p (mature (guide))
  2. Anolis carolinensis aca-miR-214-3p
  3. Artibeus jamaicensis (Jamaican fruit-eating bat) aja-miR-214
  4. Callithrix jacchus cja-miR-214
  5. Callorhinchus milii Cmi-Mir-214-v1_3p (mature (guide))
  6. Canis lupus familiaris (dog) cfa-miR-214
  7. Cavia porcellus cpo-miR-214-3p
  8. Cervus elaphus cel-miR-214
  9. Chrysemys picta bellii (western painted turtle) Cpi-Mir-214-v1_3p (mature (guide))
  10. Columba livia cli-miR-214-3p
  11. Dasypus novemcinctus (nine-banded armadillo) dno-miR-214-3p
  12. Daubentonia madagascariensis (aye-aye) dma-miR-214
  13. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-214-v1_3p (mature (guide))
  14. Equus caballus eca-miR-214
  15. Gallus gallus (chicken) Gga-Mir-214-v1_3p (mature (guide))
  16. Gekko japonicus Gja-Mir-214-v1_3p (mature (guide))
  17. Homo sapiens hsa-miR-214-3p
  18. Latimeria chalumnae Lch-Mir-214_3p (mature (guide))
  19. Macaca mulatta (Rhesus monkey) Mml-Mir-214-v1_3p (mature (guide))
  20. Microcaecilia unicolor Mun-Mir-214_3p (mature (co-guide))
  21. Microcebus murinus (gray mouse lemur) mmr-miR-214
  22. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-214-v1_3p (mature (guide))
  23. Mus musculus (house mouse) mmu-miR-214-3p
  24. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-214
  25. Ornithorhynchus anatinus oan-miR-214-3p
  26. Oryctolagus cuniculus ocu-miR-214-3p
  27. Otolemur garnettii oga-miR-214
  28. Papio hamadryas pha-miR-214
  29. Pteropus alecto pal-miR-214-3p
  30. Python bivittatus (Burmese python) pbv-miR-214-3p
  31. Rattus norvegicus (Norway rat) Rno-Mir-214-v1_3p (mature (guide))
  32. Sarcophilus harrisii Sha-Mir-214-v1_3p (mature (guide))
  33. Scyliorhinus torazame (cloudy catshark) Sto-Mir-214-v1_3p (mature (guide))
  34. Sphenodon punctatus (tuatara) Spt-Mir-214_3p (mature (guide))
  35. Taeniopygia guttata tgu-miR-214-3p
  36. Tursiops truncatus miR-214
  37. Xenopus laevis (African clawed frog) Xla-Mir-214-P3-v1_3p (mature (guide))
  38. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-214-v1_3p (mature (guide))
Publications