v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-214-3p URS00002C11C3_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-214: Hsa-mir-214 is a microRNA that has been reported to play a crucial role in regulating the proliferation and metastasis of papillary thyroid carcinoma (THCA) cells [PMC8355328]. In a study, the expression value of hsa-mir-214, along with hsa-miR-15a and hsa-miR-210, was used to define a signature for THCA cells [PMC6002353]. The signature was defined by the following equation: Dip = x1i - 68.712 + x2i - 862.542 + x3i - 1425.192 and Din = x1i - 141.162 + x2i - 346.322 + x3i - 527.862, where x1ix2ix3i represent the expression values of hsa-mir-15a, hsa-mir-210, and hsa-mir-214 for sample i [PMC6002353]. References: [PMC8355328] Liang J, Liang L, Ouyang K et al. Identification of key microRNAs and genes in papillary thyroid carcinoma by integrated bioinformatics analysis [PMC8355328]. [PMC6002353] Zhang JX, Song W et al. Prognostic role of MicroRNA-210 in various carcinomas: evidence from a meta-analysis involving 13 studies [PMC6002353].

mRNA interactions 10 total

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
ACAGCAGGCACAGACAGGCAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 38 other species

  1. Alligator mississippiensis Ami-Mir-214-v1_3p (mature (guide))
  2. Anolis carolinensis aca-miR-214-3p
  3. Artibeus jamaicensis (Jamaican fruit-eating bat) aja-miR-214
  4. Bos taurus bta-miR-214
  5. Callithrix jacchus cja-miR-214
  6. Callorhinchus milii Cmi-Mir-214-v1_3p (mature (guide))
  7. Canis lupus familiaris (dog) cfa-miR-214
  8. Cavia porcellus cpo-miR-214-3p
  9. Cervus elaphus cel-miR-214
  10. Chrysemys picta bellii (western painted turtle) Cpi-Mir-214-v1_3p (mature (guide))
  11. Columba livia cli-miR-214-3p
  12. Dasypus novemcinctus (nine-banded armadillo) dno-miR-214-3p
  13. Daubentonia madagascariensis (aye-aye) dma-miR-214
  14. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-214-v1_3p (mature (guide))
  15. Equus caballus eca-miR-214
  16. Gallus gallus (chicken) Gga-Mir-214-v1_3p (mature (guide))
  17. Gekko japonicus Gja-Mir-214-v1_3p (mature (guide))
  18. Latimeria chalumnae Lch-Mir-214_3p (mature (guide))
  19. Macaca mulatta (Rhesus monkey) Mml-Mir-214-v1_3p (mature (guide))
  20. Microcaecilia unicolor Mun-Mir-214_3p (mature (co-guide))
  21. Microcebus murinus (gray mouse lemur) mmr-miR-214
  22. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-214-v1_3p (mature (guide))
  23. Mus musculus (house mouse) mmu-miR-214-3p
  24. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-214
  25. Ornithorhynchus anatinus oan-miR-214-3p
  26. Oryctolagus cuniculus ocu-miR-214-3p
  27. Otolemur garnettii oga-miR-214
  28. Papio hamadryas pha-miR-214
  29. Pteropus alecto pal-miR-214-3p
  30. Python bivittatus (Burmese python) pbv-miR-214-3p
  31. Rattus norvegicus (Norway rat) Rno-Mir-214-v1_3p (mature (guide))
  32. Sarcophilus harrisii Sha-Mir-214-v1_3p (mature (guide))
  33. Scyliorhinus torazame (cloudy catshark) Sto-Mir-214-v1_3p (mature (guide))
  34. Sphenodon punctatus (tuatara) Spt-Mir-214_3p (mature (guide))
  35. Taeniopygia guttata tgu-miR-214-3p
  36. Tursiops truncatus miR-214
  37. Xenopus laevis (African clawed frog) Xla-Mir-214-P3-v1_3p (mature (guide))
  38. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-214-v1_3p (mature (guide))
 Publications