Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-214-3p URS00002C11C3_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-214: Mmu-mir-214 is a specific type of microRNA that has been studied in various contexts. It has been assessed for expression in mice using TaqMan RT-PCR assays [PMC4386824]. Mmu-mir-214 has been synthesized by GenePharma for use in experiments [PMC3511548]. Its role in the regulation of cytoskeletal actin has been confirmed through luciferase reporter assays and evaluation of actin-cytoskeleton architecture [PMC9379403]. Elevated expressions of mmu-mir-214 have also been reported in infected liver cells [PMC9861972]. The up-regulation of mmu-mir-214 in hepatic stellate cells (HSCs) suggests its potential as a target for anti-fibrosis therapy [PMC3692539]. Mmu-mir-214 has also been studied in the context of testis development and its over-expression has been observed in sexually immature testis compared to mature testis [PMC4049822]. It is predicted to bind to specific sites within the 3'UTR region and is differentially expressed compared to other miRNAs [PMC4902921] [PMC2923610]. Its levels have also been modulated using miR-214 mimics and inhibitors in experiments with MAECs [PMC5855744]. References: [PMC4386824] [PMC3511548] [PMC9379403] [PMC9861972] [PMC3692539] [PMC4049822] [PM4902921] [PM2923610] [PM5855744]

mRNA interactions 3 total

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACAGCAGGCACAGACAGGCAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 38 other species

  1. Alligator mississippiensis Ami-Mir-214-v1_3p (mature (guide))
  2. Anolis carolinensis aca-miR-214-3p
  3. Artibeus jamaicensis (Jamaican fruit-eating bat) aja-miR-214
  4. Bos taurus bta-miR-214
  5. Callithrix jacchus cja-miR-214
  6. Callorhinchus milii Cmi-Mir-214-v1_3p (mature (guide))
  7. Canis lupus familiaris (dog) cfa-miR-214
  8. Cavia porcellus cpo-miR-214-3p
  9. Cervus elaphus cel-miR-214
  10. Chrysemys picta bellii (western painted turtle) Cpi-Mir-214-v1_3p (mature (guide))
  11. Columba livia cli-miR-214-3p
  12. Dasypus novemcinctus (nine-banded armadillo) dno-miR-214-3p
  13. Daubentonia madagascariensis (aye-aye) dma-miR-214
  14. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-214-v1_3p (mature (guide))
  15. Equus caballus eca-miR-214
  16. Gallus gallus (chicken) Gga-Mir-214-v1_3p (mature (guide))
  17. Gekko japonicus Gja-Mir-214-v1_3p (mature (guide))
  18. Homo sapiens hsa-miR-214-3p
  19. Latimeria chalumnae Lch-Mir-214_3p (mature (guide))
  20. Macaca mulatta (Rhesus monkey) Mml-Mir-214-v1_3p (mature (guide))
  21. Microcaecilia unicolor Mun-Mir-214_3p (mature (co-guide))
  22. Microcebus murinus (gray mouse lemur) mmr-miR-214
  23. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-214-v1_3p (mature (guide))
  24. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-214
  25. Ornithorhynchus anatinus oan-miR-214-3p
  26. Oryctolagus cuniculus ocu-miR-214-3p
  27. Otolemur garnettii oga-miR-214
  28. Papio hamadryas pha-miR-214
  29. Pteropus alecto pal-miR-214-3p
  30. Python bivittatus (Burmese python) pbv-miR-214-3p
  31. Rattus norvegicus (Norway rat) Rno-Mir-214-v1_3p (mature (guide))
  32. Sarcophilus harrisii Sha-Mir-214-v1_3p (mature (guide))
  33. Scyliorhinus torazame (cloudy catshark) Sto-Mir-214-v1_3p (mature (guide))
  34. Sphenodon punctatus (tuatara) Spt-Mir-214_3p (mature (guide))
  35. Taeniopygia guttata tgu-miR-214-3p
  36. Tursiops truncatus miR-214
  37. Xenopus laevis (African clawed frog) Xla-Mir-214-P3-v1_3p (mature (guide))
  38. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-214-v1_3p (mature (guide))
Publications