Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Equus caballus (horse) eca-miR-214 URS00002C11C3_9796

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACAGCAGGCACAGACAGGCAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 38 other species

  1. Alligator mississippiensis Ami-Mir-214-v1_3p (mature (guide))
  2. Anolis carolinensis aca-miR-214-3p
  3. Artibeus jamaicensis (Jamaican fruit-eating bat) aja-miR-214
  4. Bos taurus bta-miR-214
  5. Callithrix jacchus cja-miR-214
  6. Callorhinchus milii Cmi-Mir-214-v1_3p (mature (guide))
  7. Canis lupus familiaris (dog) cfa-miR-214
  8. Cavia porcellus cpo-miR-214-3p
  9. Cervus elaphus cel-miR-214
  10. Chrysemys picta bellii (western painted turtle) Cpi-Mir-214-v1_3p (mature (guide))
  11. Columba livia cli-miR-214-3p
  12. Dasypus novemcinctus (nine-banded armadillo) dno-miR-214-3p
  13. Daubentonia madagascariensis (aye-aye) dma-miR-214
  14. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-214-v1_3p (mature (guide))
  15. Gallus gallus (chicken) Gga-Mir-214-v1_3p (mature (guide))
  16. Gekko japonicus Gja-Mir-214-v1_3p (mature (guide))
  17. Homo sapiens hsa-miR-214-3p
  18. Latimeria chalumnae Lch-Mir-214_3p (mature (guide))
  19. Macaca mulatta (Rhesus monkey) Mml-Mir-214-v1_3p (mature (guide))
  20. Microcaecilia unicolor Mun-Mir-214_3p (mature (co-guide))
  21. Microcebus murinus (gray mouse lemur) mmr-miR-214
  22. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-214-v1_3p (mature (guide))
  23. Mus musculus (house mouse) mmu-miR-214-3p
  24. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-214
  25. Ornithorhynchus anatinus oan-miR-214-3p
  26. Oryctolagus cuniculus ocu-miR-214-3p
  27. Otolemur garnettii oga-miR-214
  28. Papio hamadryas pha-miR-214
  29. Pteropus alecto pal-miR-214-3p
  30. Python bivittatus (Burmese python) pbv-miR-214-3p
  31. Rattus norvegicus (Norway rat) Rno-Mir-214-v1_3p (mature (guide))
  32. Sarcophilus harrisii Sha-Mir-214-v1_3p (mature (guide))
  33. Scyliorhinus torazame (cloudy catshark) Sto-Mir-214-v1_3p (mature (guide))
  34. Sphenodon punctatus (tuatara) Spt-Mir-214_3p (mature (guide))
  35. Taeniopygia guttata tgu-miR-214-3p
  36. Tursiops truncatus miR-214
  37. Xenopus laevis (African clawed frog) Xla-Mir-214-P3-v1_3p (mature (guide))
  38. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-214-v1_3p (mature (guide))
Publications