Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Gallus gallus (chicken) gga-miR-451 secondary structure diagram

Gallus gallus (chicken) gga-miR-451 URS00002AB26F_9031

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

gga-mir-451: Gga-mir-451 is a microRNA that has been found to target the YWHAZ gene [PMC5979595]. It has been shown to inhibit the proliferation and cell cycle progression of DF-1 cells infected with MG, a strain of Mycoplasma gallisepticum, and induce cell apoptosis [PMC5979595]. To further investigate the potential functions of gga-mir-451 in MG-HS infection, DF-1 cells were transfected with miR-451-M or miR-451-NC and then co-cultured with MG-HS for different time periods [PMC5979595]. The study examined the effects of gga-mir-451 on cell behavior in response to MG-HS infection over 24 hours, 48 hours, and 72 hours [PMC5979595]. The results of this study provide insights into the role of gga-mir-451 in regulating cell behavior during MG-HS infection and suggest that it may play a role in modulating cellular responses to this pathogen [PMC5979595]. Further research is needed to fully understand the mechanisms by which gga-mir-451 influences cellular responses during MG-HS infection and its potential as a therapeutic target for controlling Mycoplasma gallisepticum infections in poultry.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAACCGUUACCAUUACUGAGUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

2D structure Publications