Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Bos taurus (cattle) bta-miR-451 secondary structure diagram

Bos taurus (cattle) bta-miR-451 URS00002AB26F_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-451: Bta-mir-451 is a differentially expressed circular RNA (circRNA) that has been found to have regulatory relationships with various targets, including AC_000178.1_22528, AC_000169.1_14270, bta-miR-154b, and bta-mir-451 itself [PMC8946036]. It is one of the top 10 highly expressed miRNAs in all samples and has been identified as a potential biomarker for mastitis [PMC6107498] [PMC5821052]. Bta-mir-451 has been implicated in the regulation of ATF2, CDKN2D, and MEF2D [PMC5821052]. It plays different roles in the regulatory mechanisms of mastitis caused by S. aureus and E. coli infections, being up-regulated in S. aureus infected mammary glands but down-regulated in E. coli infected mammary glands [PMC5821052]. Bta-mir-451 has also been found to be up-regulated in large healthy follicles compared to small follicles [PMC5821052] [PMC6731312]. It is involved in immune responses and targets MO25 to alter AMPK signaling [PMC6600136]. Furthermore, bta-mir-451 has been detected in mammary glands infected with Staphylococcus aureus and is differentially expressed during parturition [PMC6600136] [PMC9445238]. It is also highly expressed in rumen fluid but not among the top 10 most expressed miRNAs in papillae samples [PMC9378797]. Overall, bta-mir-451 plays a significant role in various biological processes and may have potential applications as a biomarker or therapeutic target.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAACCGUUACCAUUACUGAGUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

2D structure Publications