v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Rattus norvegicus (Norway rat) Rattus_norvegicus piRNA piR-rno-62964 secondary structure diagram

Rattus norvegicus (Norway rat) Rattus_norvegicus piRNA piR-rno-62964 URS00002AB26F_10116

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AAACCGUUACCAUUACUGAGUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

  1. Bos taurus (cattle) bta-miR-451
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-451
  3. Cavia porcellus (domestic guinea pig) cpo-miR-451-5p
  4. Dasypus novemcinctus dno-miR-451-5p
  5. Gallus gallus (chicken) gga-miR-451
  6. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-72682
  7. Ophiophagus hannah (king cobra) oha-miR-451-??
  8. Ornithorhynchus anatinus (platypus) oan-miR-451
  9. Oryctolagus cuniculus ocu-miR-451-5p
  10. Sus scrofa (pig) microRNA miR-451
  11. Taeniopygia guttata (zebra finch) tgu-miR-451
  12. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-2787504
 2D structure