v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Machimus atricapillus (Kite-tailed Robberfly) misc RNA ENSAMHG00005011657.1 secondary structure diagram

Machimus atricapillus (Kite-tailed Robberfly) misc RNA ENSAMHG00005011657.1 URS00002A32AD_2794001

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGUCCUGUGGCGCAAUGGAUAACGCGUCUGACUACGGAUCAGAAGAUUCCAGGUUCGACUCCUGGCAGGAUCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 103 other species

  1. Aedes aegypti tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 35)
  2. Aedes albopictus tRNA tRNA-Arg
  3. Anastrepha ludens (Mexican fruit fly) transfer RNA arginine (anticodon ACG)
  4. Anastrepha obliqua (WestIndian fruit fly) transfer RNA arginine (anticodon ACG)
  5. Anopheles albimanus (Mosquitos) tRNA-Arg
  6. Anopheles arabiensis tRNA tRNA-Arg
  7. Anopheles atroparvus tRNA
  8. Anopheles christyi tRNA tRNA-Arg
  9. Anopheles coluzzii tRNA-Arg for anticodon ACG
  10. Anopheles culicifacies tRNA tRNA-Arg
  11. Anopheles darlingi tRNA ADAC010898
  12. Anopheles dirus tRNA tRNA-Arg
  13. Anopheles epiroticus tRNA tRNA-Arg
  14. Anopheles farauti tRNA tRNA-Arg
  15. Anopheles funestus (African malaria mosquito) tRNA-Arg for anticodon ACG
  16. Anopheles gambiae tRNA tRNA-Arg
  17. Anopheles gambiae str. PEST tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 10)
  18. Anopheles maculatus tRNA tRNA-Arg
  19. Anopheles melas tRNA tRNA-Arg
  20. Anopheles merus tRNA tRNA-Arg
  21. Anopheles minimus tRNA tRNA-Arg
  22. Anopheles quadriannulatus tRNA tRNA-Arg
  23. Anopheles sinensis tRNA tRNA-Arg
  24. Anopheles stephensi (Asian malaria mosquito) tRNA tRNA-Arg
  25. Bactrocera dorsalis transfer RNA arginine (anticodon ACG)
  26. Bactrocera latifrons (Solanum fruit fly) tRNA-Arg
  27. Bactrocera neohumeralis (Lesser Queensland fruit fly) transfer RNA arginine (anticodon ACG)
  28. Bactrocera oleae (Olive fruit fly) tRNA-Arg
  29. Bactrocera tryoni (Queensland fruitfly) tRNA-Arg
  30. Bradysia coprophila (Black fungus gnats) tRNA-Arg
  31. Pseudolycoriella hygida Bradysia hygida tRNA
  32. Ceratitis capitata (Mediterranean fruit fly) tRNA-Arg
  33. Coremacera marginata (Sieve-winged Snailkiller) misc RNA ENSCNRG00005015279.1
  34. Culex pipiens pallens (Northern house mosquito) transfer RNA arginine (anticodon ACG)
  35. Culex quinquefasciatus tRNA
  36. Drosophila albomicans (Fruit fly) transfer RNA arginine (anticodon ACG)
  37. Drosophila ananassae tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 12)
  38. Drosophila arizonae (Fruit fly) tRNA-Arg
  39. Drosophila biarmipes (Fruit fly) transfer RNA arginine (anticodon ACG)
  40. Drosophila bipectinata (Pomace flies) transfer RNA arginine (anticodon ACG)
  41. Drosophila busckii (Fruit fly) tRNA-Arg
  42. Drosophila elegans (Pomace flies) tRNA-Arg
  43. Drosophila erecta tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 9)
  44. Drosophila eugracilis (Fruit fly) tRNA-Arg
  45. Drosophila ficusphila (Fruit fly) tRNA-Arg
  46. Drosophila grimshawi tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 9)
  47. Drosophila guanche (Fruit fly) tRNA-Arg
  48. Drosophila gunungcola (Fruit fly) transfer RNA arginine (anticodon ACG)
  49. Drosophila hydei (Fruit fly) tRNA-Arg
  50. Drosophila innubila (Fruit fly) tRNA-Arg
  51. Drosophila kikkawai (Pomace flies) transfer RNA arginine (anticodon ACG)
  52. Drosophila mauritiana (Fruit fly) tRNA-Arg
  53. Drosophila melanogaster transfer RNA:Arginine-ACG 1-1 (multiple genes)
  54. Drosophila miranda (Fruit fly) tRNA-Arg
  55. Drosophila mojavensis tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 9)
  56. Drosophila montana (Pomace flies) transfer RNA arginine (anticodon ACG)
  57. Drosophila nasuta (Pomace flies) transfer RNA arginine (anticodon ACG)
  58. Drosophila navojoa (Fruit fly) tRNA-Arg
  59. Drosophila novamexicana (Pomace flies) tRNA-Arg
  60. Drosophila obscura (Fruit fly) tRNA-Arg
  61. Drosophila persimilis tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 11)
  62. Drosophila pseudoobscura (Fruit fly) tRNA-Arg
  63. Drosophila pseudoobscura pseudoobscura tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 8)
  64. Drosophila rhopaloa (Fruit fly) tRNA-Arg
  65. Drosophila santomea (Fruit fly) tRNA-Arg
  66. Drosophila sechellia tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 9)
  67. Drosophila serrata (Pomace flies) tRNA-Arg
  68. Drosophila simulans tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 9)
  69. Drosophila subobscura (Fruit fly) tRNA-Arg
  70. Drosophila subpulchrella (Fruit fly) tRNA-Arg
  71. Drosophila sulfurigaster albostrigata (Flies) transfer RNA arginine (anticodon ACG)
  72. Drosophila suzukii (Pomace flies) transfer RNA arginine (anticodon ACG)
  73. Drosophila takahashii (Pomace flies) transfer RNA arginine (anticodon ACG)
  74. Drosophila teissieri (Fruit fly) tRNA-Arg
  75. Drosophila tropicalis (Pomace flies) transfer RNA arginine (anticodon ACG)
  76. Drosophila virilis tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 10)
  77. Drosophila willistoni tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 10)
  78. Drosophila yakuba tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 12)
  79. Eumeta japonica tRNA
  80. Glossina austeni (Tsetse fly) tRNA tRNA-Arg
  81. Glossina brevipalpis tRNA tRNA-Arg
  82. Glossina fuscipes fuscipes tRNA
  83. Glossina fuscipes (Tsetse fly) tRNA-Arg
  84. Glossina morsitans morsitans (Tsetse fly) tRNA tRNA-Arg
  85. Glossina pallidipes tRNA tRNA-Arg
  86. Glossina palpalis gambiensis (Tsetse fly) tRNA tRNA-Arg
  87. Hermetia illucens (Black soldier fly) tRNA-Arg
  88. Lucilia cuprina (Australian sheep blowfly) tRNA-Arg for anticodon ACG
  89. Lucilia sericata (Common green bottle fly) tRNA-Arg
  90. Lutzomyia longipalpis (Sand fly) tRNA tRNA-Arg
  91. Malaya genurostris (Mosquitos) transfer RNA arginine (anticodon ACG)
  92. Megaselia scalaris tRNA-Arg for anticodon ACG
  93. Musca domestica (House fly) transfer RNA arginine (anticodon ACG)
  94. Myopa tessellatipennis (flies) misc RNA ENSMTEG00005013249.1
  95. Phlebotomus argentipes (Sand fly) transfer RNA arginine (anticodon ACG)
  96. Phlebotomus papatasi tRNA tRNA-Arg
  97. Rhagoletis pomonella tRNA-Arg
  98. Scaptodrosophila lebanonensis tRNA
  99. Sergentomyia squamirostris tRNA-Arg
  100. Stomoxys calcitrans (stable fly) transfer RNA arginine (anticodon ACG)
  101. Teleopsis dalmanni (Malaysian stalk-eyed fly) tRNA-Arg
  102. Topomyia yanbarensis (Mosquitos) transfer RNA arginine (anticodon ACG)
  103. Toxorhynchites rutilus septentrionalis (Elephant mosquito) transfer RNA arginine (anticodon ACG)
  104. Uranotaenia lowii (Mosquitos) transfer RNA arginine (anticodon ACG)
  105. Wyeomyia smithii (Pitcher plant Mosquito) transfer RNA arginine (anticodon ACG)
  106. Zeugodacus cucurbitae (Melon fly) transfer RNA arginine (anticodon ACG)
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...