v26

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Wyeomyia smithii (Pitcher plant Mosquito) transfer RNA arginine (anticodon ACG) secondary structure diagram

Wyeomyia smithii (Pitcher plant Mosquito) transfer RNA arginine (anticodon ACG) URS00002A32AD_174621

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGUCCUGUGGCGCAAUGGAUAACGCGUCUGACUACGGAUCAGAAGAUUCCAGGUUCGACUCCUGGCAGGAUCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 93 other species

  1. Aedes aegypti tRNA AAEL016495
  2. Aedes albopictus tRNA tRNA-Arg
  3. Anastrepha ludens (Mexican fruit fly) transfer RNA arginine (anticodon ACG)
  4. Anastrepha obliqua (WestIndian fruit fly) transfer RNA arginine (anticodon ACG)
  5. Anopheles albimanus (Mosquito) tRNA tRNA-Arg
  6. Anopheles arabiensis (Mosquito) tRNA tRNA-Arg
  7. Anopheles atroparvus tRNA
  8. Anopheles christyi tRNA tRNA-Arg
  9. Anopheles coluzzii (Mosquito) tRNA-Arg for anticodon ACG
  10. Anopheles culicifacies (Mosquito) tRNA tRNA-Arg
  11. Anopheles darlingi tRNA ADAC010898
  12. Anopheles dirus (Mosquito) tRNA tRNA-Arg
  13. Anopheles epiroticus (Mosquito) tRNA tRNA-Arg
  14. Anopheles farauti (Mosquito) tRNA tRNA-Arg
  15. Anopheles funestus tRNA-Arg for anticodon ACG
  16. Anopheles gambiae tRNA tRNA-Arg
  17. Anopheles gambiae str. PEST tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 10)
  18. Anopheles maculatus (Mosquito) tRNA tRNA-Arg
  19. Anopheles melas tRNA tRNA-Arg
  20. Anopheles merus (Mosquito) tRNA tRNA-Arg
  21. Anopheles minimus (Mosquito) tRNA tRNA-Arg
  22. Anopheles quadriannulatus (Mosquito) tRNA tRNA-Arg
  23. Anopheles sinensis (Mosquito) tRNA tRNA-Arg
  24. Anopheles stephensi (Asian malaria mosquito) tRNA tRNA-Arg
  25. Bactrocera dorsalis tRNA-Arg
  26. Bactrocera latifrons tRNA-Arg
  27. Bactrocera neohumeralis (Lesser Queensland fruit fly) transfer RNA arginine (anticodon ACG)
  28. Bactrocera tryoni tRNA-Arg
  29. Pseudolycoriella hygida Bradysia hygida tRNA
  30. Ceratitis capitata (Mediterranean fruit fly) tRNA-Arg
  31. Coremacera marginata (Sieve-winged Snailkiller) misc RNA ENSCNRG00005015279.1
  32. Culex pipiens pallens (Northern house mosquito) transfer RNA arginine (anticodon ACG)
  33. Culex quinquefasciatus tRNA-Arg
  34. Drosophila albomicans (Fruit fly) transfer RNA arginine (anticodon ACG)
  35. Drosophila ananassae tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 12)
  36. Drosophila arizonae (Fruit fly) tRNA-Arg
  37. Drosophila biarmipes (Fruit fly) transfer RNA arginine (anticodon ACG)
  38. Drosophila bipectinata (Fruit fly) tRNA-Arg
  39. Drosophila busckii (Fruit fly) tRNA-Arg
  40. Drosophila elegans (Fruit fly) tRNA-Arg
  41. Drosophila erecta tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 9)
  42. Drosophila eugracilis (Fruit fly) tRNA-Arg
  43. Drosophila ficusphila (Fruit fly) tRNA-Arg
  44. Drosophila grimshawi tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 9)
  45. Drosophila guanche (Fruit fly) tRNA-Arg
  46. Drosophila gunungcola (Fruit fly) transfer RNA arginine (anticodon ACG)
  47. Drosophila hydei (Fruit fly) tRNA-Arg
  48. Drosophila innubila (Fruit fly) tRNA-Arg
  49. Drosophila kikkawai (Fruit fly) tRNA-Arg
  50. Drosophila mauritiana (Fruit fly) tRNA-Arg
  51. Drosophila melanogaster transfer RNA:Arginine-ACG 1-1 (multiple genes)
  52. Drosophila miranda (Fruit fly) tRNA-Arg
  53. Drosophila mojavensis tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 9)
  54. Drosophila navojoa (Fruit fly) tRNA-Arg
  55. Drosophila obscura (Fruit fly) tRNA-Arg
  56. Drosophila persimilis tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 11)
  57. Drosophila pseudoobscura (Fruit fly) tRNA-Arg
  58. Drosophila pseudoobscura pseudoobscura tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 8)
  59. Drosophila rhopaloa (Fruit fly) tRNA-Arg
  60. Drosophila santomea (Fruit fly) tRNA-Arg
  61. Drosophila sechellia tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 9)
  62. Drosophila simulans tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 9)
  63. Drosophila subobscura (Fruit fly) tRNA-Arg
  64. Drosophila subpulchrella (Fruit fly) tRNA-Arg
  65. Drosophila suzukii (Fruit fly) tRNA-Arg
  66. Drosophila takahashii (Fruit fly) tRNA-Arg
  67. Drosophila teissieri (Fruit fly) tRNA-Arg
  68. Drosophila virilis tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 10)
  69. Drosophila willistoni tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 10)
  70. Drosophila yakuba tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 12)
  71. Eumeta japonica tRNA
  72. Glossina austeni tRNA tRNA-Arg
  73. Glossina brevipalpis tRNA tRNA-Arg
  74. Glossina fuscipes fuscipes tRNA
  75. Glossina morsitans morsitans tRNA tRNA-Arg
  76. Glossina pallidipes tRNA tRNA-Arg
  77. Glossina palpalis gambiensis tRNA tRNA-Arg
  78. Hermetia illucens tRNA-Arg
  79. Lucilia cuprina tRNA-Arg for anticodon ACG
  80. Lutzomyia longipalpis (Sand fly) tRNA tRNA-Arg
  81. Machimus atricapillus (Kite-tailed Robberfly) misc RNA ENSAMHG00005011657.1
  82. Malaya genurostris (Mosquitos) transfer RNA arginine (anticodon ACG)
  83. Megaselia scalaris (Coffin fly) tRNA-Arg for anticodon ACG
  84. Musca domestica tRNA MDOA012395
  85. Myopa tessellatipennis (Thick-headed flies) misc RNA ENSMTEG00005013129.1
  86. Phlebotomus argentipes (Sand fly) transfer RNA arginine (anticodon ACG)
  87. Phlebotomus papatasi tRNA tRNA-Arg
  88. Rhagoletis pomonella tRNA-Arg
  89. Scaptodrosophila lebanonensis tRNA
  90. Sergentomyia squamirostris tRNA-Arg
  91. Stomoxys calcitrans (Stable fly) tRNA-Arg
  92. Topomyia yanbarensis (Mosquitos) transfer RNA arginine (anticodon ACG)
  93. Toxorhynchites rutilus septentrionalis (Elephant mosquito) transfer RNA arginine (anticodon ACG)
  94. Uranotaenia lowii (Mosquitos) transfer RNA arginine (anticodon ACG)
  95. Zeugodacus cucurbitae (Melon fly) transfer RNA arginine (anticodon ACG)
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...