v26

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Anopheles coluzzii (Mosquito) tRNA-Arg for anticodon ACG secondary structure diagram

Anopheles coluzzii (Mosquito) tRNA-Arg for anticodon ACG URS00002A32AD_1518534

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGUCCUGUGGCGCAAUGGAUAACGCGUCUGACUACGGAUCAGAAGAUUCCAGGUUCGACUCCUGGCAGGAUCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 93 other species

  1. Aedes aegypti tRNA AAEL016495
  2. Aedes albopictus tRNA tRNA-Arg
  3. Anastrepha ludens (Mexican fruit fly) transfer RNA arginine (anticodon ACG)
  4. Anastrepha obliqua (WestIndian fruit fly) transfer RNA arginine (anticodon ACG)
  5. Anopheles albimanus (Mosquito) tRNA tRNA-Arg
  6. Anopheles arabiensis (Mosquito) tRNA tRNA-Arg
  7. Anopheles atroparvus tRNA
  8. Anopheles christyi tRNA tRNA-Arg
  9. Anopheles culicifacies (Mosquito) tRNA tRNA-Arg
  10. Anopheles darlingi tRNA ADAC010898
  11. Anopheles dirus (Mosquito) tRNA tRNA-Arg
  12. Anopheles epiroticus (Mosquito) tRNA tRNA-Arg
  13. Anopheles farauti (Mosquito) tRNA tRNA-Arg
  14. Anopheles funestus tRNA-Arg for anticodon ACG
  15. Anopheles gambiae tRNA tRNA-Arg
  16. Anopheles gambiae str. PEST tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 10)
  17. Anopheles maculatus (Mosquito) tRNA tRNA-Arg
  18. Anopheles melas tRNA tRNA-Arg
  19. Anopheles merus (Mosquito) tRNA tRNA-Arg
  20. Anopheles minimus (Mosquito) tRNA tRNA-Arg
  21. Anopheles quadriannulatus (Mosquito) tRNA tRNA-Arg
  22. Anopheles sinensis (Mosquito) tRNA tRNA-Arg
  23. Anopheles stephensi (Asian malaria mosquito) tRNA tRNA-Arg
  24. Bactrocera dorsalis tRNA-Arg
  25. Bactrocera latifrons tRNA-Arg
  26. Bactrocera neohumeralis (Lesser Queensland fruit fly) transfer RNA arginine (anticodon ACG)
  27. Bactrocera tryoni tRNA-Arg
  28. Pseudolycoriella hygida Bradysia hygida tRNA
  29. Ceratitis capitata (Mediterranean fruit fly) tRNA-Arg
  30. Coremacera marginata (Sieve-winged Snailkiller) misc RNA ENSCNRG00005015279.1
  31. Culex pipiens pallens (Northern house mosquito) transfer RNA arginine (anticodon ACG)
  32. Culex quinquefasciatus tRNA-Arg
  33. Drosophila albomicans (Fruit fly) transfer RNA arginine (anticodon ACG)
  34. Drosophila ananassae tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 12)
  35. Drosophila arizonae (Fruit fly) tRNA-Arg
  36. Drosophila biarmipes (Fruit fly) transfer RNA arginine (anticodon ACG)
  37. Drosophila bipectinata (Fruit fly) tRNA-Arg
  38. Drosophila busckii (Fruit fly) tRNA-Arg
  39. Drosophila elegans (Fruit fly) tRNA-Arg
  40. Drosophila erecta tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 9)
  41. Drosophila eugracilis (Fruit fly) tRNA-Arg
  42. Drosophila ficusphila (Fruit fly) tRNA-Arg
  43. Drosophila grimshawi tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 9)
  44. Drosophila guanche (Fruit fly) tRNA-Arg
  45. Drosophila gunungcola (Fruit fly) transfer RNA arginine (anticodon ACG)
  46. Drosophila hydei (Fruit fly) tRNA-Arg
  47. Drosophila innubila (Fruit fly) tRNA-Arg
  48. Drosophila kikkawai (Fruit fly) tRNA-Arg
  49. Drosophila mauritiana (Fruit fly) tRNA-Arg
  50. Drosophila melanogaster transfer RNA:Arginine-ACG 1-1 (multiple genes)
  51. Drosophila miranda (Fruit fly) tRNA-Arg
  52. Drosophila mojavensis tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 9)
  53. Drosophila navojoa (Fruit fly) tRNA-Arg
  54. Drosophila obscura (Fruit fly) tRNA-Arg
  55. Drosophila persimilis tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 11)
  56. Drosophila pseudoobscura (Fruit fly) tRNA-Arg
  57. Drosophila pseudoobscura pseudoobscura tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 8)
  58. Drosophila rhopaloa (Fruit fly) tRNA-Arg
  59. Drosophila santomea (Fruit fly) tRNA-Arg
  60. Drosophila sechellia tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 9)
  61. Drosophila simulans tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 9)
  62. Drosophila subobscura (Fruit fly) tRNA-Arg
  63. Drosophila subpulchrella (Fruit fly) tRNA-Arg
  64. Drosophila suzukii (Fruit fly) tRNA-Arg
  65. Drosophila takahashii (Fruit fly) tRNA-Arg
  66. Drosophila teissieri (Fruit fly) tRNA-Arg
  67. Drosophila virilis tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 10)
  68. Drosophila willistoni tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 10)
  69. Drosophila yakuba tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 12)
  70. Eumeta japonica tRNA
  71. Glossina austeni tRNA tRNA-Arg
  72. Glossina brevipalpis tRNA tRNA-Arg
  73. Glossina fuscipes fuscipes tRNA
  74. Glossina morsitans morsitans tRNA tRNA-Arg
  75. Glossina pallidipes tRNA tRNA-Arg
  76. Glossina palpalis gambiensis tRNA tRNA-Arg
  77. Hermetia illucens tRNA-Arg
  78. Lucilia cuprina tRNA-Arg for anticodon ACG
  79. Lutzomyia longipalpis (Sand fly) tRNA tRNA-Arg
  80. Machimus atricapillus (Kite-tailed Robberfly) misc RNA ENSAMHG00005011657.1
  81. Malaya genurostris (Mosquitos) transfer RNA arginine (anticodon ACG)
  82. Megaselia scalaris (Coffin fly) tRNA-Arg for anticodon ACG
  83. Musca domestica tRNA MDOA012395
  84. Myopa tessellatipennis (Thick-headed flies) misc RNA ENSMTEG00005013129.1
  85. Phlebotomus argentipes (Sand fly) transfer RNA arginine (anticodon ACG)
  86. Phlebotomus papatasi tRNA tRNA-Arg
  87. Rhagoletis pomonella tRNA-Arg
  88. Scaptodrosophila lebanonensis tRNA
  89. Sergentomyia squamirostris tRNA-Arg
  90. Stomoxys calcitrans (Stable fly) tRNA-Arg
  91. Topomyia yanbarensis (Mosquitos) transfer RNA arginine (anticodon ACG)
  92. Toxorhynchites rutilus septentrionalis (Elephant mosquito) transfer RNA arginine (anticodon ACG)
  93. Uranotaenia lowii (Mosquitos) transfer RNA arginine (anticodon ACG)
  94. Wyeomyia smithii (Pitcher plant Mosquito) transfer RNA arginine (anticodon ACG)
  95. Zeugodacus cucurbitae (Melon fly) transfer RNA arginine (anticodon ACG)
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...

 Publications