Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Anopheles dirus (Mosquito) tRNA tRNA-Arg secondary structure diagram

Anopheles dirus (Mosquito) tRNA tRNA-Arg URS00002A32AD_7168

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUCCUGUGGCGCAAUGGAUAACGCGUCUGACUACGGAUCAGAAGAUUCCAGGUUCGACUCCUGGCAGGAUCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 56 other species

  1. Aedes aegypti tRNA AAEL016495
  2. Aedes albopictus tRNA tRNA-Arg
  3. Anopheles albimanus tRNA tRNA-Arg
  4. Anopheles arabiensis tRNA tRNA-Arg
  5. Anopheles atroparvus tRNA
  6. Anopheles christyi (Mosquito) tRNA tRNA-Arg
  7. Anopheles coluzzii tRNA-Arg for anticodon ACG
  8. Anopheles culicifacies tRNA tRNA-Arg
  9. Anopheles darlingi (American malaria mosquito) tRNA ADAC010898
  10. Anopheles epiroticus (Mosquito) tRNA tRNA-Arg
  11. Anopheles farauti tRNA tRNA-Arg
  12. Anopheles funestus tRNA-Arg for anticodon ACG
  13. Anopheles gambiae (African malaria mosquito) tRNA tRNA-Arg
  14. Anopheles gambiae str. PEST tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 10)
  15. Anopheles maculatus tRNA tRNA-Arg
  16. Anopheles melas tRNA tRNA-Arg
  17. Anopheles merus (Mosquito) tRNA tRNA-Arg
  18. Anopheles minimus tRNA tRNA-Arg
  19. Anopheles quadriannulatus tRNA tRNA-Arg
  20. Anopheles sinensis (Mosquito) tRNA tRNA-Arg
  21. Anopheles stephensi tRNA tRNA-Arg
  22. Bactrocera dorsalis (Oriental fruit fly) tRNA-Arg
  23. Bactrocera latifrons (Solanum fruit fly) tRNA-Arg
  24. Bactrocera tryoni tRNA-Arg
  25. Ceratitis capitata (Mediterranean fruit fly) tRNA-Arg
  26. Culex quinquefasciatus tRNA-Arg
  27. Drosophila ananassae tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 12)
  28. Drosophila busckii tRNA
  29. Drosophila erecta tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 9)
  30. Drosophila ficusphila tRNA
  31. Drosophila grimshawi tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 9)
  32. Drosophila guanche tRNA.Arg
  33. Drosophila gunungcola tRNA-OTHER
  34. Drosophila melanogaster transfer RNA:Arginine-ACG 1-1 (multiple genes)
  35. Drosophila mojavensis tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 9)
  36. Drosophila persimilis tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 11)
  37. Drosophila pseudoobscura pseudoobscura tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 8)
  38. Drosophila sechellia tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 9)
  39. Drosophila simulans tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 9)
  40. Drosophila virilis tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 10)
  41. Drosophila willistoni tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 10)
  42. Drosophila yakuba tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 12)
  43. Glossina austeni tRNA tRNA-Arg
  44. Glossina brevipalpis tRNA tRNA-Arg
  45. Glossina fuscipes fuscipes tRNA
  46. Glossina morsitans morsitans tRNA tRNA-Arg
  47. Glossina pallidipes tRNA tRNA-Arg
  48. Glossina palpalis gambiensis tRNA tRNA-Arg
  49. Hermetia illucens (Black soldier fly) tRNA-Arg
  50. Lucilia cuprina (Australian sheep blowfly) tRNA-Arg for anticodon ACG
  51. Lutzomyia longipalpis tRNA tRNA-Arg
  52. Megaselia scalaris (Coffin fly) tRNA-Arg for anticodon ACG
  53. Musca domestica tRNA MDOA012395
  54. Phlebotomus papatasi tRNA tRNA-Arg
  55. Rhagoletis pomonella tRNA-Arg
  56. Stomoxys calcitrans tRNA-Arg
2D structure