Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-204 URS000029D9F1_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-204: Bta-mir-204 is a miRNA that was identified as one of the highly enriched miRNAs in a previous study [PMC7505075]. It is classified as a non-DA miRNA [PMC7505075]. In the study, bta-mir-204 was found to negatively regulate the expression of BoLA (Bovine Leukocyte Antigen) by directly binding to its complementary sequence in the 3'-UTR (3'-untranslated region) of BoLA in a sequence-specific manner [PMC8056107]. This suggests that bta-mir-204 plays a role in regulating the expression of BoLA, which is involved in immune responses and disease resistance in cattle [PMC8056107]. The presence of bta-mir-204 among the top 20 abundant miRNAs indicates its potential importance and involvement in various biological processes [PMC7505075]. The identification and characterization of bta-mir-204 provide insights into the regulatory mechanisms underlying immune responses and disease resistance in cattle. Further studies may be warranted to explore its specific functions and potential applications.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCCCUUUGUCAUCCUAUGCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 60 other species

  1. Alligator mississippiensis (American alligator) ami-miR-204-5p
  2. Anolis carolinensis aca-miR-204a-5p
  3. Callithrix jacchus cja-miR-204
  4. Callorhinchus milii (elephant shark) Cmi-Mir-204-P1_5p (mature (guide))
  5. Canis lupus familiaris cfa-miR-204
  6. Capra hircus (goat) chi-miR-204-5p
  7. Cavia porcellus cpo-miR-204-5p
  8. Cervus elaphus cel-miR-204
  9. Chiloscyllium plagiosum microRNA cpl-miR-204
  10. Chrysemys picta bellii (western painted turtle) Cpi-Mir-204-P1_5p (mature (guide))
  11. Chrysemys picta cpi-miR-204-5p
  12. Columba livia cli-miR-204-5p
  13. Cricetulus griseus cgr-miR-204
  14. Danio rerio (zebrafish) dre-miR-204-5p
  15. Dasypus novemcinctus (nine-banded armadillo) dno-miR-204-5p
  16. Echinops telfairi Ete-Mir-204-P2_5p (mature (guide))
  17. Equus caballus eca-miR-204b
  18. Gadus morhua gmo-miR-204-5p
  19. Gallus gallus (chicken) gga-miR-204
  20. Gekko japonicus Gja-Mir-204-P1_5p (mature (guide))
  21. Gorilla gorilla gorilla ggo-miR-204 (MIR204)
  22. Gorilla gorilla ggo-miR-204
  23. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-204
  24. Homo sapiens (human) hsa-miR-204-5p
  25. Ictalurus punctatus (channel catfish) ipu-miR-204
  26. Latimeria chalumnae (coelacanth) Lch-Mir-204-P1_5p (mature (guide))
  27. Lepisosteus oculatus Loc-Mir-204-P1_5p (mature (guide))
  28. Macaca mulatta (Rhesus monkey) mml-miR-204-5p
  29. Macaca nemestrina (pig-tailed macaque) mne-miR-204
  30. Maylandia zebra mze-miR-204
  31. Microcaecilia unicolor Mun-Mir-204-P1_5p (mature (guide))
  32. Microcebus murinus mmr-miR-204
  33. Monodelphis domestica (gray short-tailed opossum) mdo-miR-204
  34. Monopterus albus (swamp eel) Mal-Mir-204-P1b_5p (mature (guide))
  35. Mus musculus mmu-miR-204-5p
  36. Neolamprologus brichardi (lyretail cichlid) nbr-miR-204
  37. Ophiophagus hannah (king cobra) oha-miR-204-5p
  38. Oreochromis niloticus (Nile tilapia) oni-miR-204a
  39. Ornithorhynchus anatinus (platypus) oan-miR-204-5p
  40. Oryctolagus cuniculus (rabbit) ocu-miR-204-5p
  41. Pan paniscus ppa-miR-204
  42. Pan troglodytes ptr-miR-204
  43. Petromyzon marinus pma-miR-204-5p
  44. Pongo pygmaeus (Bornean orangutan) ppy-miR-204
  45. Pteropus alecto pal-miR-204-5p
  46. Pundamilia nyererei pny-miR-204
  47. Python bivittatus Pbv-Mir-204-P1_5p (mature (guide))
  48. Rattus norvegicus rno-miR-204-5p
  49. Saguinus labiatus (red-chested mustached tamarin) sla-miR-204
  50. Salmo salar (Atlantic salmon) ssa-miR-204-5p
  51. Sarcophilus harrisii Sha-Mir-204-P1_5p (mature (guide))
  52. Scyliorhinus torazame (cloudy catshark) Sto-Mir-204-P2_5p (mature (guide))
  53. Sphenodon punctatus (tuatara) Spt-Mir-204-P2_5p (mature (guide))
  54. Sus scrofa ssc-miR-204
  55. Taeniopygia guttata tgu-miR-204
  56. Takifugu rubripes (torafugu) fru-miR-204a
  57. Tetraodon nigroviridis tni-miR-204a
  58. Tor tambroides (Thai mahseer) miR-204-5p
  59. Xenopus laevis Xla-Mir-204-P1c_5p (mature (guide))
  60. Xenopus tropicalis xtr-miR-204
Publications