Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Tetraodon nigroviridis (spotted green pufferfish) tni-miR-214
URS00002524E1_99883
Genome locations
Gene Ontology annotations
Loading ontology ancestors...
Failed to load QuickGO Ancestor chart
Sequence
Sequence features are shown above as colored rectangles.
Zoom in and click to view details, or
Reset
ACAGCAGGCACAGACAGGCAG
Taxonomic tree
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree.
Click tree nodes to collapse or expand them.
Hover over taxon names to display additional information.
This sequence is found in 22 other species
Download