Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pan troglodytes (chimpanzee) ptr-miR-214 URS00002524E1_9598

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACAGCAGGCACAGACAGGCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 22 other species

  1. Alligator mississippiensis (American alligator) ami-miR-214-3p
  2. Ateles geoffroyi age-miR-214
  3. Danio rerio dre-miR-214
  4. Gadus morhua (Atlantic cod) gmo-miR-214-3p
  5. Gallus gallus gga-miR-214
  6. Gorilla gorilla gorilla ggo-miR-214 (MIR214)
  7. Gorilla gorilla (western gorilla) ggo-miR-214
  8. Homo sapiens microRNA mir-214
  9. Macaca mulatta mml-miR-214-3p
  10. Macaca nemestrina (pig-tailed macaque) mne-miR-214
  11. Monodelphis domestica (gray short-tailed opossum) mdo-miR-214-3p
  12. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-72662
  13. Pan paniscus ppa-miR-214
  14. Pongo pygmaeus (Bornean orangutan) ppy-miR-214
  15. Rattus norvegicus rno-miR-214-3p
  16. Saguinus labiatus sla-miR-214
  17. Sus scrofa ssc-miR-214-3p
  18. Takifugu rubripes (torafugu) fru-miR-214
  19. Tetraodon nigroviridis tni-miR-214
  20. Tor tambroides miR-214
  21. Xenopus laevis (African clawed frog) xla-miR-214-3p
  22. Xenopus tropicalis (tropical clawed frog) xtr-miR-214
Publications