Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-214-3p URS00002524E1_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-214: Ssc-mir-214 is a microRNA that has been found to be up-regulated in ER compared to LL sows and is involved in promoting apoptosis and suppressing cell proliferation in various cell types [PMC6677090]. It has been identified as a homolog of hsa-miR-214-3p, mmu-miR-214-3p, dre-miR-214, and ssc-mir-214 [PMC4710718]. In PCMV-infected lung, liver, spleen, kidney, and thymus samples, ssc-mir-214 was found to be one of the most downregulated miRNAs compared to uninfected samples [PMC5774105]. It has also been identified as a downregulated hub miRNA in various contexts [PMC5796217]. Ssc-mir-214 has been associated with Salmonella infection and plays a role in the regulation of ovarian function and follicular development [PMC4521145] [PMC7912685]. In different tissues infected with various pathogens or under different conditions, ssc-mir-214 has shown both upregulation and downregulation compared to control samples [PMC5326932] [PMC4646468] [PMC8529057] [PMC8367414] [PMC10093425]. Ssc-mir-214 has been found to have regulatory effects on target genes involved in the VEGF signaling pathway as well as the HIF-1 related signaling pathway [PMC4646468]  [ PMC8529057 ]. It is also involved in the regulation of target genes through miRNA-mRNA networks [ PMC10093425 ].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACAGCAGGCACAGACAGGCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 22 other species

  1. Alligator mississippiensis (American alligator) ami-miR-214-3p
  2. Ateles geoffroyi age-miR-214
  3. Danio rerio dre-miR-214
  4. Gadus morhua (Atlantic cod) gmo-miR-214-3p
  5. Gallus gallus gga-miR-214
  6. Gorilla gorilla gorilla ggo-miR-214 (MIR214)
  7. Gorilla gorilla (western gorilla) ggo-miR-214
  8. Homo sapiens microRNA mir-214
  9. Macaca mulatta mml-miR-214-3p
  10. Macaca nemestrina (pig-tailed macaque) mne-miR-214
  11. Monodelphis domestica (gray short-tailed opossum) mdo-miR-214-3p
  12. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-72662
  13. Pan paniscus ppa-miR-214
  14. Pan troglodytes (chimpanzee) ptr-miR-214
  15. Pongo pygmaeus (Bornean orangutan) ppy-miR-214
  16. Rattus norvegicus rno-miR-214-3p
  17. Saguinus labiatus sla-miR-214
  18. Takifugu rubripes (torafugu) fru-miR-214
  19. Tetraodon nigroviridis tni-miR-214
  20. Tor tambroides miR-214
  21. Xenopus laevis (African clawed frog) xla-miR-214-3p
  22. Xenopus tropicalis (tropical clawed frog) xtr-miR-214
Publications