Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-214 URS00002524E1_9031

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

gga-mir-214: Gga-mir-214 is a microRNA that has been extensively studied in various contexts [PMC9188098]. It has been found to regulate the greatest number of target genes among differentially expressed microRNAs (DEMs), with 5 targets [PMC9188098]. In a study on the KO-IFNAR1 group, gga-mir-214 was found to be one of the eight most significantly down-regulated genes [PMC9611459]. It has also been identified as one of the upregulated miRNAs in LB strain, showing enrichment with its target genes [PMC8241840]. Furthermore, gga-mir-214 was found to be significantly up-regulated in chicken thymus under immunosuppressive conditions [PMC7894119]. In another study, gga-mir-214 was chosen as one of the DEMs to validate its expression trend using qPCR [PMC8633681]. Additionally, gga-mir-214 was found to be up-regulated in infected samples compared to control samples [PMC7931527]. The expression levels of gga-mir-214 were also evaluated in resistant and susceptible chickens, showing higher levels in resistant chickens [PMC7931527]. Moreover, gga-mir-214 has been identified as one of the miRNAs targeting key gene TGFB3 in various signaling pathways [PMC6815035]. It has also been found to interact with other genes involved in different pathways such as ABC transporters and PPAR pathway [PMC5788541]. Finally, gga-mir-214 was significantly expressed in both abdominal preadipocytes and differentiated adipocytes but at different rates compared to other miRNAs studied [PMC8002044].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACAGCAGGCACAGACAGGCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 22 other species

  1. Alligator mississippiensis (American alligator) ami-miR-214-3p
  2. Ateles geoffroyi age-miR-214
  3. Danio rerio dre-miR-214
  4. Gadus morhua (Atlantic cod) gmo-miR-214-3p
  5. Gorilla gorilla gorilla ggo-miR-214 (MIR214)
  6. Gorilla gorilla (western gorilla) ggo-miR-214
  7. Homo sapiens microRNA mir-214
  8. Macaca mulatta mml-miR-214-3p
  9. Macaca nemestrina (pig-tailed macaque) mne-miR-214
  10. Monodelphis domestica (gray short-tailed opossum) mdo-miR-214-3p
  11. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-72662
  12. Pan paniscus ppa-miR-214
  13. Pan troglodytes (chimpanzee) ptr-miR-214
  14. Pongo pygmaeus (Bornean orangutan) ppy-miR-214
  15. Rattus norvegicus rno-miR-214-3p
  16. Saguinus labiatus sla-miR-214
  17. Sus scrofa ssc-miR-214-3p
  18. Takifugu rubripes (torafugu) fru-miR-214
  19. Tetraodon nigroviridis tni-miR-214
  20. Tor tambroides miR-214
  21. Xenopus laevis (African clawed frog) xla-miR-214-3p
  22. Xenopus tropicalis (tropical clawed frog) xtr-miR-214
Publications