Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-128-3p URS000024A59E_9606

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Homo sapiens. Annotated by 10 databases (IntAct, MalaCards, ENA, PSICQUIC, LncBase, MirGeneDB, RefSeq, GeneCards, TarBase, miRBase). Described in 98 papers. Homo sapiens (human) hsa-miR-128-3p sequence is a product of hsa-miR-128-3p, 128, miR-128-3p, miR-128, MIR128-2, 128b, mir-128b, MIR128-1, hsa-miR-128 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 1-8D, 14-3-3, 16E1BP, 182-FIP, 2'-PDE, 209L8, 20D7-FC4, 2C4D, 2H9, 3635.

Interactions 22

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-128-3p interacts with:

Interaction id Participant Synonyms
EBI-25772487 intact:EBI-25682775 EBI-25682775 ENST00000337514 mrna_igf1
EBI-25773001 intact:EBI-25773021 EBI-25773021 ENST00000521381 mrna_pik3r1
EBI-25773016 intact:EBI-25773037 EBI-25773037 ENST00000357387 mrna_rictor
EBI-25773011 intact:EBI-25773402 EBI-25773402 ENST00000361445 mrna_mtor
URS000024A59E_9606-0 O95477 O95477
URS000024A59E_9606-1 O95477 O95477
URS000024A59E_9606-10 O95477 O95477
URS000024A59E_9606-9 O95477 O95477
URS000024A59E_9606-11 O95816 O95816
URS000024A59E_9606-2 O95816 O95816
URS000024A59E_9606-12 P01130 P01130
URS000024A59E_9606-3 P01130 P01130
URS000024A59E_9606-4 P09603 P09603
URS000024A59E_9606-13 P09603 P09603
URS000024A59E_9606-5 P19793 P19793
URS000024A59E_9606-14 P19793 P19793
URS000024A59E_9606-8 P29323 P29323
URS000024A59E_9606-15 P29323 P29323
URS000024A59E_9606-16 P45844 P45844
URS000024A59E_9606-6 P45844 P45844
URS000024A59E_9606-7 P54762 P54762
URS000024A59E_9606-17 P54762 P54762

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UCACAGUGAACCGGUCUCUUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 106 other species

    1. Alligator mississippiensis ami-miR-128-3p
    2. Anolis carolinensis aca-miR-128-3p
    3. Bos taurus (cattle) bta-miR-128
    4. Callithrix jacchus cja-miR-128
    5. Callorhinchus milii (elephant shark) eshark_mir-128_1
    6. Canis lupus familiaris cfa-miR-128
    7. Capra hircus chi-miR-128-3p
    8. Cavia porcellus (domestic guinea pig) cpo-miR-128-3p
    9. Cervus elaphus (red deer) cel-miR-128
    10. Chiloscyllium plagiosum microRNA cpl-miR-128
    11. Chrysemys picta bellii Cpi-Mir-128-P1_3p (mature (guide))
    12. Chrysemys picta (Painted turtle) cpi-miR-128-3p
    13. Columba livia (rock pigeon) cli-miR-128-3p
    14. Cricetulus griseus cgr-miR-128-3p
    15. Cyprinus carpio ccr-miR-128
    16. Danio rerio (zebrafish) Dre-Mir-128-P1b_3p (mature (guide))
    17. Dasypus novemcinctus (nine-banded armadillo) dno-miR-128-3p
    18. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-128-P1_3p (mature (guide))
    19. Equus caballus (horse) eca-miR-128
    20. Gadus morhua gmo-miR-128-3p
    21. Gallus gallus (chicken) gga-miR-128-3p
    22. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-128
    23. Ictalurus punctatus (channel catfish) ipu-miR-128
    24. Macaca mulatta mml-miR-128b-3p
    25. Maylandia zebra mze-miR-128
    26. Microcebus murinus mmr-miR-128
    27. Monodelphis domestica mdo-miR-128a-3p
    28. Mus musculus (house mouse) mmu-miR-128-3p
    29. Nomascus leucogenys nle-miR-128
    30. Oreochromis niloticus oni-miR-128
    31. Ornithorhynchus anatinus oan-miR-128-3p
    32. Oryctolagus cuniculus (rabbit) ocu-miR-128a-3p
    33. Otolemur garnettii oga-miR-128
    34. Pan troglodytes (chimpanzee) ptr-miR-128
    35. Pongo pygmaeus ppy-miR-128
    36. Pteropus alecto pal-miR-128-3p
    37. Pundamilia nyererei pny-miR-128
    38. Python bivittatus pbv-miR-128-3p
    39. Rattus norvegicus rno-miR-128-3p
    40. Salmo salar (Atlantic salmon) ssa-miR-128-3p
    41. Sarcophilus harrisii sha-miR-128
    42. Scyliorhinus torazame (cloudy catshark) Sto-Mir-128-P1_3p (mature (guide))
    43. Sus scrofa ssc-miR-128
    44. Taeniopygia guttata (zebra finch) tgu-miR-128-3p
    45. Tupaia chinensis tch-miR-128
    46. Xenopus laevis (African clawed frog) xla-miR-128-3p
    47. Xenopus tropicalis Xtr-Mir-128-P1_3p (mature (guide))