Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-128 URS000024A59E_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-miR-128: Bta-mir-128, a microRNA, is part of a network of differentially expressed microRNAs (DEmiRNAs) and their target genes [PMC6720277]. It has been found to be upregulated in the L group and may play a role in rumen development by regulating the expression of PPARG and SLC16A1 [PMC6720277]. The binding site of bta-mir-128 on the 3' untranslated region (UTR) of the PPARG gene was mutated to investigate its regulatory relationship [PMC6720277]. Luciferase assays confirmed that bta-mir-128 can suppress the activity of wild-type PPARG and SLC16A1 reporter vectors, but this suppression is disrupted when mutations are introduced in the seed region of bta-mir-128 [PMC6720277]. The negative regulatory relationship between bta-mir-128 and its target genes, including PPARG and SLC16A1, was further validated by analyzing other DEmiRNAs and their target genes [PMC6720277]. Bta-mir-128 was also found to have a high betweenness in a network analysis comparing differentially expressed miRNAs at different time points [PMC9445238]. Additionally, it was identified as one of the differentially expressed miRNAs in comparisons between different groups [PMC10000098].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCACAGUGAACCGGUCUCUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 54 other species

  1. Alligator mississippiensis ami-miR-128-3p
  2. Anolis carolinensis aca-miR-128-3p
  3. Callithrix jacchus cja-miR-128
  4. Callorhinchus milii (elephant shark) Cmi-Mir-128-P1_3p (mature (guide))
  5. Canis lupus familiaris cfa-miR-128
  6. Capra hircus chi-miR-128-3p
  7. Cavia porcellus cpo-miR-128-3p
  8. Cervus elaphus cel-miR-128
  9. Chiloscyllium plagiosum microRNA cpl-miR-128
  10. Chrysemys picta bellii Cpi-Mir-128-P1_3p (mature (guide))
  11. Chrysemys picta (Painted turtle) cpi-miR-128-3p
  12. Columba livia (rock pigeon) cli-miR-128-3p
  13. Cricetulus griseus (Chinese hamster) cgr-miR-128-3p
  14. Cyprinus carpio (common carp) ccr-miR-128
  15. Danio rerio Dre-Mir-128-P2b_3p (mature (guide))
  16. Dasypus novemcinctus dno-miR-128-3p
  17. Echinops telfairi Ete-Mir-128-P1_3p (mature (guide))
  18. Equus caballus (horse) eca-miR-128
  19. Gadus morhua (Atlantic cod) gmo-miR-128-3p
  20. Gallus gallus gga-miR-128-3p
  21. Gekko japonicus Gja-Mir-128-P1_3p (mature (guide))
  22. Haplochromis burtoni abu-miR-128
  23. Homo sapiens (human) hsa-miR-128-3p
  24. Ictalurus punctatus (channel catfish) ipu-miR-128
  25. Latimeria chalumnae (coelacanth) Lch-Mir-128-P1_3p (mature (guide))
  26. Lepisosteus oculatus Loc-Mir-128-P1_3p (mature (guide))
  27. Macaca mulatta (Rhesus monkey) mml-miR-128b-3p
  28. Maylandia zebra (zebra mbuna) mze-miR-128
  29. Microcaecilia unicolor Mun-Mir-128-P1_3p (mature (guide))
  30. Microcebus murinus mmr-miR-128
  31. Monodelphis domestica mdo-miR-128b-3p
  32. Monopterus albus (swamp eel) Mal-Mir-128-P1_3p (mature (guide))
  33. Mus musculus mmu-miR-128-3p
  34. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-128
  35. Oreochromis niloticus oni-miR-128
  36. Ornithorhynchus anatinus (platypus) oan-miR-128-3p
  37. Oryctolagus cuniculus (rabbit) ocu-miR-128b-3p
  38. Otolemur garnettii oga-miR-128
  39. Pan troglodytes ptr-miR-128
  40. Pongo pygmaeus (Bornean orangutan) ppy-miR-128
  41. Pteropus alecto pal-miR-128-3p
  42. Pundamilia nyererei pny-miR-128
  43. Python bivittatus (Burmese python) pbv-miR-128-3p
  44. Rattus norvegicus (Norway rat) rno-miR-128-3p
  45. Salmo salar ssa-miR-128-3p
  46. Sarcophilus harrisii sha-miR-128
  47. Scyliorhinus torazame Sto-Mir-128-P1_3p (mature (guide))
  48. Sphenodon punctatus (tuatara) Spt-Mir-128-P1_3p (mature (guide))
  49. Sus scrofa ssc-miR-128
  50. Taeniopygia guttata (zebra finch) tgu-miR-128-3p
  51. Tetraodon nigroviridis (spotted green pufferfish) Tni-Mir-128-P2a_3p (mature (guide))
  52. Tupaia chinensis (Chinese tree shrew) tch-miR-128
  53. Xenopus laevis xla-miR-128-3p
  54. Xenopus tropicalis Xtr-Mir-128-P1_3p (mature (guide))
Publications