Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Equus caballus (horse) eca-miR-128 URS000024A59E_9796

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

eca-miR-128: Eca-mir-128 is a microRNA that targets the gene CXCL16, which is involved in the persistence of Equine Arteritis Virus (EAV) infection [PMC9559303]. It has been detected in seminal plasma extracellular vesicles (EVs) of infected stallions [PMC9559303]. In-silico analysis using TargetScan identified eca-mir-128 as the most significant differentially expressed microRNA (DEmiR) [PMC5748701]. DESeq2 analysis identified eca-mir-128 as one of the 11 statistically significant DEmiRs, along with other miRNAs such as eca-miR-744, eca-miR-197, and eca-miR-103 [PMC5748701]. TargetScan database revealed 212 potential target genes for eca-mir-128 [PMC5748701]. In a comparison between edgeR and DESeq2 analyses, it was found that eca-mir-128 was not significantly affected by hemolysis levels [PMC5748701]. In a study involving long-term carrier stallions infected with EAV KY84, no differences were observed in terms of neutralizing antibody levels, viral output in semen, and gene expression profile in the ampullae among these stallions [PMC6692045]. EAV long-term persistence is associated with upregulation of CXCL16 and downregulation of eca-mir-128 in seminal exosomes [PMC6692045]. Eca-mir-128 has also been implicated in muscle cell proliferation, differentiation, and energy expenditure [PMC9498731]. Furthermore, it has been shown to regulate airway remodeling and CD4+ T cell maturation and differentiation in an equine model of severe asthma [PMC8372030].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCACAGUGAACCGGUCUCUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 54 other species

  1. Alligator mississippiensis ami-miR-128-3p
  2. Anolis carolinensis aca-miR-128-3p
  3. Bos taurus (cattle) bta-miR-128
  4. Callithrix jacchus cja-miR-128
  5. Callorhinchus milii (elephant shark) Cmi-Mir-128-P1_3p (mature (guide))
  6. Canis lupus familiaris cfa-miR-128
  7. Capra hircus chi-miR-128-3p
  8. Cavia porcellus cpo-miR-128-3p
  9. Cervus elaphus cel-miR-128
  10. Chiloscyllium plagiosum microRNA cpl-miR-128
  11. Chrysemys picta bellii Cpi-Mir-128-P1_3p (mature (guide))
  12. Chrysemys picta (Painted turtle) cpi-miR-128-3p
  13. Columba livia (rock pigeon) cli-miR-128-3p
  14. Cricetulus griseus (Chinese hamster) cgr-miR-128-3p
  15. Cyprinus carpio (common carp) ccr-miR-128
  16. Danio rerio Dre-Mir-128-P2b_3p (mature (guide))
  17. Dasypus novemcinctus dno-miR-128-3p
  18. Echinops telfairi Ete-Mir-128-P1_3p (mature (guide))
  19. Gadus morhua (Atlantic cod) gmo-miR-128-3p
  20. Gallus gallus gga-miR-128-3p
  21. Gekko japonicus Gja-Mir-128-P1_3p (mature (guide))
  22. Haplochromis burtoni abu-miR-128
  23. Homo sapiens (human) hsa-miR-128-3p
  24. Ictalurus punctatus (channel catfish) ipu-miR-128
  25. Latimeria chalumnae (coelacanth) Lch-Mir-128-P1_3p (mature (guide))
  26. Lepisosteus oculatus Loc-Mir-128-P1_3p (mature (guide))
  27. Macaca mulatta (Rhesus monkey) mml-miR-128b-3p
  28. Maylandia zebra (zebra mbuna) mze-miR-128
  29. Microcaecilia unicolor Mun-Mir-128-P1_3p (mature (guide))
  30. Microcebus murinus mmr-miR-128
  31. Monodelphis domestica mdo-miR-128b-3p
  32. Monopterus albus (swamp eel) Mal-Mir-128-P1_3p (mature (guide))
  33. Mus musculus mmu-miR-128-3p
  34. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-128
  35. Oreochromis niloticus oni-miR-128
  36. Ornithorhynchus anatinus (platypus) oan-miR-128-3p
  37. Oryctolagus cuniculus (rabbit) ocu-miR-128b-3p
  38. Otolemur garnettii oga-miR-128
  39. Pan troglodytes ptr-miR-128
  40. Pongo pygmaeus (Bornean orangutan) ppy-miR-128
  41. Pteropus alecto pal-miR-128-3p
  42. Pundamilia nyererei pny-miR-128
  43. Python bivittatus (Burmese python) pbv-miR-128-3p
  44. Rattus norvegicus (Norway rat) rno-miR-128-3p
  45. Salmo salar ssa-miR-128-3p
  46. Sarcophilus harrisii sha-miR-128
  47. Scyliorhinus torazame Sto-Mir-128-P1_3p (mature (guide))
  48. Sphenodon punctatus (tuatara) Spt-Mir-128-P1_3p (mature (guide))
  49. Sus scrofa ssc-miR-128
  50. Taeniopygia guttata (zebra finch) tgu-miR-128-3p
  51. Tetraodon nigroviridis (spotted green pufferfish) Tni-Mir-128-P2a_3p (mature (guide))
  52. Tupaia chinensis (Chinese tree shrew) tch-miR-128
  53. Xenopus laevis xla-miR-128-3p
  54. Xenopus tropicalis Xtr-Mir-128-P1_3p (mature (guide))
Publications