Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-128 URS000024A59E_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-miR-128: Ssc-mir-128 is a microRNA that has been found to play a role in regulating various cellular processes and signaling pathways. It has been shown to be involved in the regulation of the cell cycle and neurotrophin signaling pathway, along with other microRNAs such as ssc-miR-20b, ssc-miR-497, ssc-miR-195, and ssc-miR-371-5p [PMC4934789]. Ssc-mir-128 has also been identified as one of the candidate microRNAs in different studies. For example, it was found to be upregulated at D100 compared to E90 [PMC4423774]. It was also found to potentially regulate the chemotaxis of immune cells [PMC8851844]. In another study, ssc-mir-128 was upregulated in DON-exposed piglets and showed a strong increase in abundance [PMC8585098]. Ssc-mir-128 has been identified as one of the microRNAs that can potentially serve as biomarkers for assessing DON effects [PMC8585098]. It has also been shown to have target genes involved in various pathways such as MAPK gene family and PIK3 gene family [PMC10000162]. Additionally, ssc-mir-128 has been found to be differentially expressed in PRRSV-infected pigs and is involved in PRRSV-induced immune response and invasion [PMC10000162]. Overall, ssc-mir-128 is a versatile microRNA with potential roles in various cellular processes and diseases.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCACAGUGAACCGGUCUCUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 54 other species

  1. Alligator mississippiensis ami-miR-128-3p
  2. Anolis carolinensis aca-miR-128-3p
  3. Bos taurus (cattle) bta-miR-128
  4. Callithrix jacchus cja-miR-128
  5. Callorhinchus milii (elephant shark) Cmi-Mir-128-P1_3p (mature (guide))
  6. Canis lupus familiaris cfa-miR-128
  7. Capra hircus chi-miR-128-3p
  8. Cavia porcellus cpo-miR-128-3p
  9. Cervus elaphus cel-miR-128
  10. Chiloscyllium plagiosum microRNA cpl-miR-128
  11. Chrysemys picta bellii Cpi-Mir-128-P1_3p (mature (guide))
  12. Chrysemys picta (Painted turtle) cpi-miR-128-3p
  13. Columba livia (rock pigeon) cli-miR-128-3p
  14. Cricetulus griseus (Chinese hamster) cgr-miR-128-3p
  15. Cyprinus carpio (common carp) ccr-miR-128
  16. Danio rerio Dre-Mir-128-P2b_3p (mature (guide))
  17. Dasypus novemcinctus dno-miR-128-3p
  18. Echinops telfairi Ete-Mir-128-P1_3p (mature (guide))
  19. Equus caballus (horse) eca-miR-128
  20. Gadus morhua (Atlantic cod) gmo-miR-128-3p
  21. Gallus gallus gga-miR-128-3p
  22. Gekko japonicus Gja-Mir-128-P1_3p (mature (guide))
  23. Haplochromis burtoni abu-miR-128
  24. Homo sapiens (human) hsa-miR-128-3p
  25. Ictalurus punctatus (channel catfish) ipu-miR-128
  26. Latimeria chalumnae (coelacanth) Lch-Mir-128-P1_3p (mature (guide))
  27. Lepisosteus oculatus Loc-Mir-128-P1_3p (mature (guide))
  28. Macaca mulatta (Rhesus monkey) mml-miR-128b-3p
  29. Maylandia zebra (zebra mbuna) mze-miR-128
  30. Microcaecilia unicolor Mun-Mir-128-P1_3p (mature (guide))
  31. Microcebus murinus mmr-miR-128
  32. Monodelphis domestica mdo-miR-128b-3p
  33. Monopterus albus (swamp eel) Mal-Mir-128-P1_3p (mature (guide))
  34. Mus musculus mmu-miR-128-3p
  35. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-128
  36. Oreochromis niloticus oni-miR-128
  37. Ornithorhynchus anatinus (platypus) oan-miR-128-3p
  38. Oryctolagus cuniculus (rabbit) ocu-miR-128b-3p
  39. Otolemur garnettii oga-miR-128
  40. Pan troglodytes ptr-miR-128
  41. Pongo pygmaeus (Bornean orangutan) ppy-miR-128
  42. Pteropus alecto pal-miR-128-3p
  43. Pundamilia nyererei pny-miR-128
  44. Python bivittatus (Burmese python) pbv-miR-128-3p
  45. Rattus norvegicus (Norway rat) rno-miR-128-3p
  46. Salmo salar ssa-miR-128-3p
  47. Sarcophilus harrisii sha-miR-128
  48. Scyliorhinus torazame Sto-Mir-128-P1_3p (mature (guide))
  49. Sphenodon punctatus (tuatara) Spt-Mir-128-P1_3p (mature (guide))
  50. Taeniopygia guttata (zebra finch) tgu-miR-128-3p
  51. Tetraodon nigroviridis (spotted green pufferfish) Tni-Mir-128-P2a_3p (mature (guide))
  52. Tupaia chinensis (Chinese tree shrew) tch-miR-128
  53. Xenopus laevis xla-miR-128-3p
  54. Xenopus tropicalis Xtr-Mir-128-P1_3p (mature (guide))
Publications