Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-335 URS0000237AF9_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-335: Bta-mir-335 is a miRNA that regulates PRLR and is involved in linseed oil-treated cows [PMC9821774]. In linseed oil-treated cows, bta-mir-335, miR-200a, and bta-miR-2299-5p are down-regulated and target 1163 genes [PMC4628385]. In addition, bta-mir-335 is one of the most significant DE-bta-miRNAs that target 3'UTR of 273 genes with high confidence [PMC9437019]. Bta-mir-335 is not detected in granulosa cells of DF [PMC4156418]. Bta-mir-335 is one of the differentially expressed miRNAs in theca cells during the estrous cycle [PMC4156418]. The expression pattern of selected miRNAs in theca cells shows similarity to that of granulosa cells in SF compared to DF, except for miR-2487 and bta-mir-335 [PMC4156418]. The expression trend of selected miRNAs in theca cells at day 3 of the estrous cycle is similar to that of corresponding granulosa cells except for bta-miR-34c and bta-mir-335 [PMC4156418]. Bta-mir-335 is one of the nine differentially expressed candidate miRNAs validated by qPCR [PMC4438052]. Bta-mir-335 shows higher relative abundance in subordinate follicles compared to preovulatory dominant follicles in terms of follicular fluid and theca cells [PMC4438052]. Furthermore, preovulatory dominant follicles exhibit reduced expression levels for other matured miRNAs including bta-miR409a, bta-miR378, and btm-MIR17.5p [PMC4438052].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCAAGAGCAAUAACGAAAAAUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

  1. Canis lupus familiaris (dog) cfa-miR-335
  2. Capra hircus miR-335
  3. Cervus elaphus cel-miR-335
  4. Eptesicus fuscus efu-miR-335
  5. Equus caballus eca-miR-335
  6. Homo sapiens hsa-miR-335-5p
  7. Macaca mulatta mml-miR-335-5p
  8. Mus musculus (house mouse) mmu-miR-335-5p
  9. Ovis aries (sheep) miscellaneous RNA
  10. Pan troglodytes (chimpanzee) ptr-miR-335
  11. Pongo pygmaeus (Bornean orangutan) ppy-miR-335
  12. Rattus norvegicus rno-miR-335
Publications