Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-335 URS0000237AF9_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-335: Rno-mir-335 is a miRNA that exhibits a decreasing expression level in the Wistar islet upon stimulation at 16.7G compared to 2.8G [PMC3072418]. This finding is supported by experimental validation of the interaction between rno-mir-335 and Stxbp1 3′UTR [PMC3072418]. The expression changes of miRNAs in the Wistar islet were observed within a short temporal window of one hour, including rno-miR-130a, rno-miR-132, rno-miR-212, and rno-mir-335 [PMC3072418]. The differential expression levels of these miRNAs were comparable when assessed by microarray or qRT-PCR analysis, except for rno-mir-335 [PMC6215356]. Additionally, three trends in terms of expression changes were observed in the Wistar islet upon stimulation at 16.7G compared to 2.8G: increasing miRNA levels for rno-miR-132, rno-miR-212, and rno-miR-409-3p; decreasing miRNA levels for rno-miR-124, rno-miR1423p,rn omi R375,rn omi R130a,and rn omi R708; and no significant change for rn omi R376a,rn omi R1425p,and rn omi R433 [PMC3072418].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCAAGAGCAAUAACGAAAAAUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

  1. Bos taurus (cattle) bta-miR-335
  2. Canis lupus familiaris (dog) cfa-miR-335
  3. Capra hircus miR-335
  4. Cervus elaphus cel-miR-335
  5. Eptesicus fuscus efu-miR-335
  6. Equus caballus eca-miR-335
  7. Homo sapiens hsa-miR-335-5p
  8. Macaca mulatta mml-miR-335-5p
  9. Mus musculus (house mouse) mmu-miR-335-5p
  10. Ovis aries (sheep) miscellaneous RNA
  11. Pan troglodytes (chimpanzee) ptr-miR-335
  12. Pongo pygmaeus (Bornean orangutan) ppy-miR-335
Publications