Macaca mulatta (Rhesus monkey) mml-miR-335-5p URS0000237AF9_9544

• 23 nucleotides
• 3 databases (ENA, miRBase, RefSeq)
• Found in 12 other species
• 1906 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UCAAGAGCAAUAACGAAAAAUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

1. Bos taurus (cattle) bta-miR-335
2. Canis lupus familiaris (dog) cfa-miR-335
3. Capra hircus miR-335
4. Cervus elaphus cel-miR-335
5. Eptesicus fuscus efu-miR-335
6. Equus caballus eca-miR-335
7. Homo sapiens hsa-miR-335-5p
8. Mus musculus (house mouse) mmu-miR-335-5p
9. Ovis aries (sheep) miscellaneous RNA
10. Pan troglodytes (chimpanzee) ptr-miR-335
11. Pongo pygmaeus (Bornean orangutan) ppy-miR-335
12. Rattus norvegicus rno-miR-335

Publications Download

• FASTA
• JSON