Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Brassica rapa (field mustard) bra-miR156e-5p URS000020F5A7_3711

Automated summary: This miRNA sequence is 20 nucleotides long and is found in Brassica rapa. Annotated by 2 databases (miRBase, RefSeq). Brassica rapa (field mustard) bra-miR156e-5p sequence is a product of bra-miR156a-5p, bra-miR156g-5p, miR156d-5p, bra-miR156d, MIR156B, miR156e, miR156a, MIR156A, miR156g, bra-miR156g, MIR156D, bra-miR156e, miR156b-5p, miR156c, bra-miR156f-5p, bra-miR156e-5p, bra-miR156c-5p, MIR156G, miR156b, bra-miR156f, bra-miR156d-5p, miR156f-5p, miR156a-5p, bra-miR156b, MIR156C, miR156g-5p, miR156f, miR156e-5p, miR156, miR156d, MIR156E, bra-miR156b-5p, miR156c-5p, bra-miR156c, bra-miR156a, MIR156F genes. Found in the field mustard reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UGACAGAAGAGAGUGAGCAC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 48 other species

    1. Aegilops tauschii ata-miR156d-5p
    2. Amborella trichopoda atr-miR156d
    3. Ananas comosus (pineapple) microRNA 156i
    4. Arabidopsis lyrata aly-miR156e-5p
    5. Arabidopsis thaliana (thale cress) ath-miR156d-5p
    6. Asparagus officinalis aof-miR156a
    7. Brachypodium distachyon bdi-miR156e-5p
    8. Brassica napus (rape) bna-miR156e
    9. Camelina sativa (false flax) cas-miR156c-5p
    10. Carica papaya (papaya) cpa-miR156a
    11. Citrus sinensis csi-miR156c-5p
    12. Citrus trifoliata ctr-miR156
    13. Cucumis melo (muskmelon) cme-miR156i
    14. Cynara cardunculus cca-miR156a
    15. Digitalis purpurea (common foxglove) dpr-miR156b
    16. Eucalyptus globulus MICRORNA156.5
    17. Fragaria vesca subsp. vesca fve-miR156d
    18. Glycine max gma-miR156w
    19. Gossypium hirsutum (cotton) ghr-miR156d
    20. Helianthus annuus han-miR156a
    21. Helianthus argophyllus har-miR156a
    22. Helianthus tuberosus htu-miR156a
    23. Linum usitatissimum (flax) lus-miR156a
    24. Malus domestica mdm-miR156k
    25. Manihot esculenta (cassava) mes-miR156g
    26. Medicago truncatula mtr-miR156d-5p
    27. Nicotiana tabacum nta-miR156a
    28. Ophiorrhiza prostrata miRNA-156a
    29. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR156b-5p
    30. Oryza sativa osa-miR156j-5p
    31. Physcomitrium patens ppt-miR156b
    32. Picea abies pab-miR156l
    33. Populus tomentosa Pto-miR156b
    34. Populus trichocarpa ptc-miR156e
    35. Prunus persica ppe-miR156e
    36. Rauvolfia tetraphylla miRNA-156a
    37. Rosa chinensis ath-miR156a-5p
    38. Saccharum officinarum sof-miR156
    39. Solanum lycopersicum sly-miR156d-5p
    40. Solanum tuberosum stu-miR156g-5p
    41. Sorghum bicolor (sorghum) sbi-miR156g
    42. Theobroma cacao (cacao) tcc-miR156g
    43. Tinospora cordifolia miRNA-156a
    44. Triticum aestivum tae-csmR156-1
    45. Vigna unguiculata vun-miR156a
    46. Vitis vinifera (wine grape) vvi-miR156b
    47. Vriesea carinata vca-miR156a-5p
    48. Zea mays zma-miR156l-5p
    Publications New