v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-142-5p URS00001E0AEA_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-142: Hsa-mir-142 is one of the 10 significantly differentially expressed miRNAs that were selected for validation using the RT-qPCR method. It is an upregulated miRNA with a relatively high fold-change (fold-change ≥4 or ≤-4) [PMC5865992]. In a study on head and neck squamous cell carcinoma (HNSC) patients, high plasma levels of hsa-mir-142 were reported as a HPV-independent prognostic marker for combined radio-chemotherapy [PMC7794682]. References: - [PMC5865992]: This reference provides information on the selection and validation of differentially expressed miRNAs using the RT-qPCR method. - [PMC7794682]: This reference discusses the association between high plasma levels of hsa-mir-142 and prognosis in HNSC patients undergoing combined radio-chemotherapy.

mRNA interactions 2 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CAUAAAGUAGAAAGCACUACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 43 other species

  1. Alligator mississippiensis (American alligator) Ami-Mir-142-P1-v1_5p (mature (guide))
  2. Anolis carolinensis Aca-Mir-142-P2-v1_5p (mature (guide))
  3. Bos taurus (cattle) Bta-Mir-142-P1-v1_5p (mature (guide))
  4. Callorhinchus milii (elephant shark) Cmi-Mir-142-P1-v1_5p (mature (guide))
  5. Canis lupus familiaris (dog) Cfa-Mir-142-P1-v1_5p (mature (guide))
  6. Cavia porcellus (domestic guinea pig) cpo-miR-142-5p
  7. Chrysemys picta bellii (western painted turtle) Cpi-Mir-142-P2-v1_5p (mature (guide))
  8. Columba livia (rock pigeon) cli-miR-142-5p
  9. Danio rerio (zebrafish) dre-miR-142a-5p
  10. Dasypus novemcinctus (nine-banded armadillo) dno-miR-142-5p
  11. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-142-P1-v1_5p (mature (guide))
  12. Eptatretus burgeri Ebu-Mir-142-v1_5p (mature (guide))
  13. Equus caballus eca-miR-142-5p
  14. Gadus morhua (Atlantic cod) gmo-miR-142-5p
  15. Gallus gallus (chicken) Gga-Mir-142-P1-v1_5p (mature (guide))
  16. Gekko japonicus Gja-Mir-142-P2-v1_5p (mature (guide))
  17. Haplochromis burtoni abu-miR-142-5p
  18. Latimeria chalumnae (coelacanth) Lch-Mir-142-P1_5p (mature (guide))
  19. Lepisosteus oculatus Loc-Mir-142-P1-v1_5p (mature (guide))
  20. Macaca mulatta (Rhesus monkey) mml-miR-142-5p
  21. Maylandia zebra (zebra mbuna) mze-miR-142
  22. Monodelphis domestica Mdo-Mir-142-P1-v1_5p (mature (guide))
  23. Monopterus albus Mal-Mir-142-P2-v1_5p (mature (guide))
  24. Mus musculus mmu-miR-142a-5p
  25. Neolamprologus brichardi (lyretail cichlid) nbr-miR-142
  26. Oreochromis niloticus (Nile tilapia) oni-miR-142
  27. Ornithorhynchus anatinus (platypus) oan-miR-142-5p
  28. Oryctolagus cuniculus (rabbit) ocu-miR-142-5p
  29. Pongo pygmaeus ppy-miR-142-5p
  30. Pundamilia nyererei pny-miR-142
  31. Python bivittatus Pbv-Mir-142-P2-v1_5p (mature (guide))
  32. Rattus norvegicus rno-miR-142-5p
  33. Salmo salar (Atlantic salmon) ssa-miR-142a-5p
  34. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-142-P1-v1_5p (mature (guide))
  35. Scyliorhinus torazame (cloudy catshark) Sto-Mir-142-P1-v1_5p (mature (guide))
  36. Sphenodon punctatus Spt-Mir-142-P1_5p (mature (guide))
  37. Sus scrofa ssc-miR-142-5p
  38. Taeniopygia guttata (zebra finch) Tgu-Mir-142-P1-v1_5p (mature (guide))
  39. Takifugu rubripes (torafugu) fru-miR-142
  40. Tetraodon nigroviridis tni-miR-142a
  41. Tor tambroides miR-142a-5p
  42. Xenopus laevis Xla-Mir-142-P1b2-v1_5p (mature (guide))
  43. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-142-P1b-v1_5p (mature (guide))
 Publications