Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-142a-5p URS00001E0AEA_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-142: Mmu-mir-142 is a microRNA that plays significant roles in immune regulation and various biological processes such as the development of nasopharynx carcinoma, cell cycling, IL-6 modulation in hematopoietic cell tissues, mature T cell proliferation, and endotoxin-induced mortality in inflammatory processes [Sun et al., 2011, 2013, 2015; PMC6176049]. It has been observed that mmu-mir-142 and mmu-miR-101 overexpression is related to γδT CD27+ (IL-17-) cells [PMC8234718]. Maternal immunization with OVA has been shown to influence the thymic expression of mmu-miR-15a, mmu-miR-101, mmu-miR-126, and mmu-mir-142 in offspring as part of the mechanism of IL-17-producing γδT cells inhibition [PMC8234718]. Additionally, highly significant CISs (common integration sites) have been found near genes such as Pik3r5 and Pik3cd that have not previously been linked to tumorigenesis [PMC2405818]. Microarray datasets from knockout experiments have shown the effects of mmu-mir-142 on its exclusive targets [PMC3919606]. Mmu-mir-142 has also been observed in studies related to Chlamydia pathogenesis [PMC6379932]. Both mmu-mir-142-3p and mmu-mir-142–5p are derived from the stem loop precursor of mmu-mir–142 [PMC3319598]. Furthermore, a study has connected mmu-mir–142 with obesity; however, further experiments are needed to elucidate its role in this process [PMC3319598].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAUAAAGUAGAAAGCACUACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 43 other species

  1. Alligator mississippiensis (American alligator) Ami-Mir-142-P1-v1_5p (mature (guide))
  2. Anolis carolinensis Aca-Mir-142-P2-v1_5p (mature (guide))
  3. Bos taurus (cattle) Bta-Mir-142-P1-v1_5p (mature (guide))
  4. Callorhinchus milii (elephant shark) Cmi-Mir-142-P1-v1_5p (mature (guide))
  5. Canis lupus familiaris (dog) Cfa-Mir-142-P1-v1_5p (mature (guide))
  6. Cavia porcellus (domestic guinea pig) cpo-miR-142-5p
  7. Chrysemys picta bellii (western painted turtle) Cpi-Mir-142-P2-v1_5p (mature (guide))
  8. Columba livia (rock pigeon) cli-miR-142-5p
  9. Danio rerio (zebrafish) dre-miR-142a-5p
  10. Dasypus novemcinctus (nine-banded armadillo) dno-miR-142-5p
  11. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-142-P1-v1_5p (mature (guide))
  12. Eptatretus burgeri Ebu-Mir-142-v1_5p (mature (guide))
  13. Equus caballus eca-miR-142-5p
  14. Gadus morhua (Atlantic cod) gmo-miR-142-5p
  15. Gallus gallus (chicken) Gga-Mir-142-P1-v1_5p (mature (guide))
  16. Gekko japonicus Gja-Mir-142-P2-v1_5p (mature (guide))
  17. Haplochromis burtoni abu-miR-142-5p
  18. Homo sapiens (human) hsa-miR-142-5p
  19. Latimeria chalumnae (coelacanth) Lch-Mir-142-P1_5p (mature (guide))
  20. Lepisosteus oculatus Loc-Mir-142-P1-v1_5p (mature (guide))
  21. Macaca mulatta (Rhesus monkey) mml-miR-142-5p
  22. Maylandia zebra (zebra mbuna) mze-miR-142
  23. Monodelphis domestica Mdo-Mir-142-P1-v1_5p (mature (guide))
  24. Monopterus albus Mal-Mir-142-P2-v1_5p (mature (guide))
  25. Neolamprologus brichardi (lyretail cichlid) nbr-miR-142
  26. Oreochromis niloticus (Nile tilapia) oni-miR-142
  27. Ornithorhynchus anatinus (platypus) oan-miR-142-5p
  28. Oryctolagus cuniculus (rabbit) ocu-miR-142-5p
  29. Pongo pygmaeus ppy-miR-142-5p
  30. Pundamilia nyererei pny-miR-142
  31. Python bivittatus Pbv-Mir-142-P2-v1_5p (mature (guide))
  32. Rattus norvegicus rno-miR-142-5p
  33. Salmo salar (Atlantic salmon) ssa-miR-142a-5p
  34. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-142-P1-v1_5p (mature (guide))
  35. Scyliorhinus torazame (cloudy catshark) Sto-Mir-142-P1-v1_5p (mature (guide))
  36. Sphenodon punctatus Spt-Mir-142-P1_5p (mature (guide))
  37. Sus scrofa ssc-miR-142-5p
  38. Taeniopygia guttata (zebra finch) Tgu-Mir-142-P1-v1_5p (mature (guide))
  39. Takifugu rubripes (torafugu) fru-miR-142
  40. Tetraodon nigroviridis tni-miR-142a
  41. Tor tambroides miR-142a-5p
  42. Xenopus laevis Xla-Mir-142-P1b2-v1_5p (mature (guide))
  43. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-142-P1b-v1_5p (mature (guide))
Publications