Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Xenopus laevis (African clawed frog) Xla-Mir-142-P1b2-v1_5p (mature (guide)) URS00001E0AEA_8355

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAUAAAGUAGAAAGCACUACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 43 other species

  1. Alligator mississippiensis (American alligator) Ami-Mir-142-P1-v1_5p (mature (guide))
  2. Anolis carolinensis Aca-Mir-142-P2-v1_5p (mature (guide))
  3. Bos taurus (cattle) Bta-Mir-142-P1-v1_5p (mature (guide))
  4. Callorhinchus milii (elephant shark) Cmi-Mir-142-P1-v1_5p (mature (guide))
  5. Canis lupus familiaris (dog) Cfa-Mir-142-P1-v1_5p (mature (guide))
  6. Cavia porcellus (domestic guinea pig) cpo-miR-142-5p
  7. Chrysemys picta bellii (western painted turtle) Cpi-Mir-142-P2-v1_5p (mature (guide))
  8. Columba livia (rock pigeon) cli-miR-142-5p
  9. Danio rerio (zebrafish) dre-miR-142a-5p
  10. Dasypus novemcinctus (nine-banded armadillo) dno-miR-142-5p
  11. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-142-P1-v1_5p (mature (guide))
  12. Eptatretus burgeri Ebu-Mir-142-v1_5p (mature (guide))
  13. Equus caballus eca-miR-142-5p
  14. Gadus morhua (Atlantic cod) gmo-miR-142-5p
  15. Gallus gallus (chicken) Gga-Mir-142-P1-v1_5p (mature (guide))
  16. Gekko japonicus Gja-Mir-142-P2-v1_5p (mature (guide))
  17. Haplochromis burtoni abu-miR-142-5p
  18. Homo sapiens (human) hsa-miR-142-5p
  19. Latimeria chalumnae (coelacanth) Lch-Mir-142-P1_5p (mature (guide))
  20. Lepisosteus oculatus Loc-Mir-142-P1-v1_5p (mature (guide))
  21. Macaca mulatta (Rhesus monkey) mml-miR-142-5p
  22. Maylandia zebra (zebra mbuna) mze-miR-142
  23. Monodelphis domestica Mdo-Mir-142-P1-v1_5p (mature (guide))
  24. Monopterus albus Mal-Mir-142-P2-v1_5p (mature (guide))
  25. Mus musculus mmu-miR-142a-5p
  26. Neolamprologus brichardi (lyretail cichlid) nbr-miR-142
  27. Oreochromis niloticus (Nile tilapia) oni-miR-142
  28. Ornithorhynchus anatinus (platypus) oan-miR-142-5p
  29. Oryctolagus cuniculus (rabbit) ocu-miR-142-5p
  30. Pongo pygmaeus ppy-miR-142-5p
  31. Pundamilia nyererei pny-miR-142
  32. Python bivittatus Pbv-Mir-142-P2-v1_5p (mature (guide))
  33. Rattus norvegicus rno-miR-142-5p
  34. Salmo salar (Atlantic salmon) ssa-miR-142a-5p
  35. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-142-P1-v1_5p (mature (guide))
  36. Scyliorhinus torazame (cloudy catshark) Sto-Mir-142-P1-v1_5p (mature (guide))
  37. Sphenodon punctatus Spt-Mir-142-P1_5p (mature (guide))
  38. Sus scrofa ssc-miR-142-5p
  39. Taeniopygia guttata (zebra finch) Tgu-Mir-142-P1-v1_5p (mature (guide))
  40. Takifugu rubripes (torafugu) fru-miR-142
  41. Tetraodon nigroviridis tni-miR-142a
  42. Tor tambroides miR-142a-5p
  43. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-142-P1b-v1_5p (mature (guide))