Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-126-5p URS00001D69F6_9606

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (ENA, MirGeneDB, LncBase, MalaCards, RefSeq, miRBase, TarBase, GeneCards). Described in 66 papers. Homo sapiens (human) hsa-miR-126-5p sequence is a product of miR-126, hsa-miR-126-5p, MIR126, hsa-miR-126, miR-126-5p genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 14-3-3-zeta, 14-3-3GAMMA, 14-3-3γ, 182-FIP, 2700066J21Rik, 2C18, 2C4D, 2P1, 30ST3B1, 39K2.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CAUUAUUACUUUUGGUACGCG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 39 other species

    1. Alligator mississippiensis (American alligator) ami-miR-126-5p
    2. Anolis carolinensis aca-miR-126-5p
    3. Bos taurus bta-miR-126-5p
    4. Canis lupus familiaris (dog) cfa-miR-126
    5. Cavia porcellus Cpo-Mir-126-v1_5p (mature (guide))
    6. Cervus elaphus cel-miR-126*
    7. Chiloscyllium plagiosum microRNA cpl-miR-126*
    8. Chrysemys picta bellii (western painted turtle) Cpi-Mir-126-v1_5p (mature (guide))
    9. Chrysemys picta (Painted turtle) cpi-miR-126-5p
    10. Columba livia (rock pigeon) Cli-Mir-126-v1_5p (mature (guide))
    11. Cyprinus carpio ccr-miR-126-5p
    12. Danio rerio (zebrafish) dre-miR-126a-5p
    13. Dasypus novemcinctus (nine-banded armadillo) Dno-Mir-126-v1_5p (mature (guide))
    14. Echinops telfairi Ete-Mir-126-v1_5p (mature (guide))
    15. Equus caballus eca-miR-126-5p
    16. Gadus morhua (Atlantic cod) gmo-miR-126-5p
    17. Gallus gallus (chicken) gga-miR-126-5p
    18. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-126-5p
    19. Ictalurus punctatus ipu-miR-126b
    20. Macaca mulatta (Rhesus monkey) Mml-Mir-126-v1_5p (mature (guide))
    21. Maylandia zebra mze-miR-126
    22. Microcebus murinus mmr-miR-126
    23. Monodelphis domestica mdo-miR-126-5p
    24. Mus musculus (house mouse) mmu-miR-126a-5p
    25. Neolamprologus brichardi nbr-miR-126
    26. Nomascus leucogenys nle-miR-126
    27. Oreochromis niloticus oni-miR-126
    28. Ornithorhynchus anatinus (platypus) oan-miR-126-5p
    29. Oryzias latipes ola-miR-126-5p
    30. Pundamilia nyererei pny-miR-126
    31. Python bivittatus (Burmese python) pbv-miR-126-5p
    32. Rattus norvegicus (Norway rat) rno-miR-126a-5p
    33. Salmo salar ssa-miR-126-5p
    34. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-126-v1_5p* (star (passenger))
    35. Scyliorhinus torazame Sto-Mir-126-v1_5p (mature (guide))
    36. Sus scrofa ssc-miR-126-5p
    37. Taeniopygia guttata Tgu-Mir-126-v1_5p (mature (guide))
    38. Tor tambroides (Thai mahseer) miR-126b-5p
    39. Xenopus laevis (African clawed frog) xla-miR-126-5p
    40. Xenopus tropicalis xtr-miR-126-5p