Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-708 URS000019D79B_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-708: Bta-mir-708 is a microRNA that has been found to be up-regulated in high RFI animals [PMC5003961]. It is one of the most significant differentially expressed bta-miRNAs, with a high fold change and a low false discovery rate [PMC9437019]. Bta-mir-708 has been observed to be up-regulated at 4 hpi and 2 hpi in certain conditions [PMC3589390]. It has also been found to be highly enriched in the follicular fluid of subordinate follicles compared to dominant follicles [PMC4438052]. Bta-mir-708, along with other miRNAs, has been selected for validation through quantitative real-time PCR (qPCR) [PMC4438052]. Furthermore, bta-mir-708 has been shown to be up-regulated in the LPS+FTA groups compared with the LPS group, as confirmed by RT-qPCR [PMC7943879]. Bta-mir-708 is part of ceRNA regulatory networks involving lncRNAs and mRNAs [PMC7969984]. Additionally, it has been found to be enriched in SF at day 3 of the estrous cycle but repressed at day 7 compared to DF groups [PMC4156418]. Bta-mir-708, along with other differentially expressed miRNAs, has also been analyzed in theca cells [PMC4156418].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAGGAGCUUACAAUCUAGCUGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-708
  2. Canis lupus familiaris (dog) cfa-miR-708
  3. Capra hircus (goat) chi-miR-708-5p
  4. Cavia porcellus (domestic guinea pig) cpo-miR-708-5p
  5. Dasypus novemcinctus dno-miR-708-5p
  6. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-28-P3_5p (mature (co-guide))
  7. Equus caballus eca-miR-708
  8. Homo sapiens hsa-miR-708-5p
  9. Macaca mulatta (Rhesus monkey) mml-miR-708-5p
  10. Microcebus murinus (gray mouse lemur) mmr-miR-708
  11. Mus musculus mmu-miR-708-5p
  12. Oryctolagus cuniculus ocu-miR-708-5p
  13. Pan troglodytes ptr-miR-708
  14. Papio hamadryas pha-miR-708
  15. Pongo pygmaeus ppy-miR-708
  16. Rattus norvegicus rno-miR-708-5p
  17. Sus scrofa (pig) ssc-miR-708-5p
  18. Tupaia chinensis tch-miR-708-5p
Publications