Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Callithrix jacchus (white-tufted-ear marmoset) cja-miR-708 URS000019D79B_9483

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAGGAGCUUACAAUCUAGCUGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Bos taurus bta-miR-708
  2. Canis lupus familiaris (dog) cfa-miR-708
  3. Capra hircus (goat) chi-miR-708-5p
  4. Cavia porcellus (domestic guinea pig) cpo-miR-708-5p
  5. Dasypus novemcinctus dno-miR-708-5p
  6. Echinops telfairi Ete-Mir-28-P3_5p (mature (co-guide))
  7. Equus caballus eca-miR-708
  8. Homo sapiens hsa-miR-708-5p
  9. Macaca mulatta (Rhesus monkey) mml-miR-708-5p
  10. Microcebus murinus (gray mouse lemur) mmr-miR-708
  11. Mus musculus mmu-miR-708-5p
  12. Oryctolagus cuniculus (rabbit) ocu-miR-708-5p
  13. Pan troglodytes ptr-miR-708
  14. Papio hamadryas pha-miR-708
  15. Pongo pygmaeus (Bornean orangutan) ppy-miR-708
  16. Rattus norvegicus rno-miR-708-5p
  17. Sus scrofa ssc-miR-708-5p
  18. Tupaia chinensis (Chinese tree shrew) tch-miR-708-5p