Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-708-5p URS000019D79B_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-708: Mmu-mir-708 is a microRNA that was synthesized and duplexed with the same sequences in miRBase [PMC4703836]. It is one of the 10 differentially expressed (DE) miRNAs with the highest degree in a network analysis [PMC6833270]. In a study on rodents subjected to perinatal protein malnutrition, mmu-mir-708 was found to be increased at 21 days of life [PMC9127546]. It, along with mmu-miR-879, had a total of 349 validated target genes in the miRWalk database [PMC5372868]. The primers used for mmu-mir-708 were identified by their specific IDs [PMC5372868]. Furthermore, mmu-mir-708 was significantly upregulated in the study (fold change ≥ 2 and p value < 0.05) [PMC5372868]. References: [PMC4703836] - Available at: http://www.mirbase.org/ [PMC6833270] - Available at: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6833270/ [PMC6209654] - Available at: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6209654/ [Sosa-Larios et al., 2017] - Sosa-Larios TC, et al. (2017) Perinatal protein malnutrition alters microRNA expression and mRNA target genes in rat liver. Gene Expr Patterns. 25-26:1-10. [PMC9127546] - Available at: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9127546/ [PMC5372868] - Available at: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5372868/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAGGAGCUUACAAUCUAGCUGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Bos taurus bta-miR-708
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-708
  3. Canis lupus familiaris (dog) cfa-miR-708
  4. Capra hircus (goat) chi-miR-708-5p
  5. Cavia porcellus (domestic guinea pig) cpo-miR-708-5p
  6. Dasypus novemcinctus dno-miR-708-5p
  7. Echinops telfairi Ete-Mir-28-P3_5p (mature (co-guide))
  8. Equus caballus eca-miR-708
  9. Homo sapiens hsa-miR-708-5p
  10. Macaca mulatta (Rhesus monkey) mml-miR-708-5p
  11. Microcebus murinus (gray mouse lemur) mmr-miR-708
  12. Oryctolagus cuniculus (rabbit) ocu-miR-708-5p
  13. Pan troglodytes ptr-miR-708
  14. Papio hamadryas pha-miR-708
  15. Pongo pygmaeus (Bornean orangutan) ppy-miR-708
  16. Rattus norvegicus rno-miR-708-5p
  17. Sus scrofa ssc-miR-708-5p
  18. Tupaia chinensis (Chinese tree shrew) tch-miR-708-5p
Publications