Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Dasypus novemcinctus (nine-banded armadillo) dno-miR-708-5p URS000019D79B_9361

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAGGAGCUUACAAUCUAGCUGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 20 other species

  1. Bos taurus (domestic cattle) bta-miR-708
  2. Callithrix jacchus cja-miR-708
  3. Canis lupus familiaris (dog) cfa-miR-708
  4. Capra hircus (goat) chi-miR-708-5p
  5. Cavia porcellus (domestic guinea pig) cpo-miR-708-5p
  6. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-708_5p (mature (co-guide))
  7. Equus caballus (horse) eca-miR-708
  8. Homo sapiens hsa-miR-708-5p
  9. Loxodonta africana (African savanna elephant) Laf-Mir-708_5p (mature (guide))
  10. Macaca mulatta mml-miR-708-5p
  11. Microcebus murinus mmr-miR-708
  12. Mus musculus (house mouse) mmu-miR-708-5p
  13. Oryctolagus cuniculus (rabbit) ocu-miR-708-5p
  14. Pan troglodytes ptr-miR-708
  15. Papio hamadryas pha-miR-708
  16. Pongo abelii (Sumatran orangutan) Pab-Mir-708_5p (mature (guide))
  17. Pongo pygmaeus (Bornean orangutan) ppy-miR-708
  18. Rattus norvegicus rno-miR-708-5p
  19. Sus scrofa (pig) ssc-miR-708-5p
  20. Tupaia belangeri chinensis tch-miR-708-5p
Relationships

Molecular Relationships