Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-708-5p URS000019D79B_9606

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (ENA, PSICQUIC, TarBase, GeneCards, LncBase, MirGeneDB, RefSeq, miRBase, MalaCards). Homo sapiens (human) hsa-miR-708-5p sequence is a product of MIR708, MIR-RG-74 variant 1, hsa-miR-708, HSA-MIR-RG-74 variant 1, hsa-miR-708-5p, miR-708-5p, miR-708 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 14-3-3-zeta, 16.3A5, 182-FIP, 82-FIP, AAIR8193, AAR2, AASD-PPT, AASDHPPT, ABIN-2, ABP620.

Interactions 2

According to PSICQUIC, Homo sapiens (human) hsa-miR-708-5p interacts with:

Interaction id Participant Synonyms
URS000019D79B_9606-0 O00206 O00206
URS000019D79B_9606-1 O00206 O00206

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AAGGAGCUUACAAUCUAGCUGGG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 124 other species

    1. Bos taurus bta-miR-708
    2. Callithrix jacchus cja-miR-708
    3. Canis lupus familiaris cfa-miR-708
    4. Capra hircus (goat) chi-miR-708-5p
    5. Cavia porcellus cpo-miR-708-5p
    6. Dasypus novemcinctus dno-miR-708-5p
    7. Echinops telfairi Ete-Mir-28-P3_5p (mature (co-guide))
    8. Equus caballus (horse) eca-miR-708
    9. Macaca mulatta (Rhesus monkey) mml-miR-708-5p
    10. Microcebus murinus (gray mouse lemur) mmr-miR-708
    11. Mus musculus mmu-miR-708-5p
    12. Oryctolagus cuniculus ocu-miR-708-5p
    13. Pan troglodytes ptr-miR-708
    14. Papio hamadryas pha-miR-708
    15. Pongo pygmaeus (Bornean orangutan) ppy-miR-708
    16. Rattus norvegicus rno-miR-708-5p
    17. Sus scrofa (pig) ssc-miR-708-5p
    18. Tupaia chinensis tch-miR-708-5p
    Publications New