Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-708-5p URS000019D79B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-708: Hsa-mir-708 is one of the 18 miRNAs that were found to be consistently over-expressed in lung cancer tumor tissues [PMC10137184]. In a study, oligonucleotides for Ambion® hsa-mir-708–5p mimics, negative control, and hsa-mir-708 inhibitors were transfected into cells using TransIT-X2® transfection reagent [PMC6768854]. The over-expression of hsa-mir-708 in lung cancer tumor tissues suggests its potential role in the development and progression of lung cancer [PMC10137184]. The specific function and mechanism of hsa-mir-708 in lung cancer are yet to be fully understood. However, it is known that miRNAs play a crucial role in regulating gene expression by binding to the 3' untranslated region (UTR) of target mRNAs [PMC10137184]. Further research is needed to investigate the target genes and pathways regulated by hsa-mir-708 in lung cancer. Understanding the role of hsa-mir-708 may provide insights into potential therapeutic targets for lung cancer treatment [PMC10137184].

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAGGAGCUUACAAUCUAGCUGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Bos taurus bta-miR-708
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-708
  3. Canis lupus familiaris (dog) cfa-miR-708
  4. Capra hircus (goat) chi-miR-708-5p
  5. Cavia porcellus (domestic guinea pig) cpo-miR-708-5p
  6. Dasypus novemcinctus dno-miR-708-5p
  7. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-28-P3_5p (mature (co-guide))
  8. Equus caballus eca-miR-708
  9. Macaca mulatta (Rhesus monkey) mml-miR-708-5p
  10. Microcebus murinus (gray mouse lemur) mmr-miR-708
  11. Mus musculus mmu-miR-708-5p
  12. Oryctolagus cuniculus ocu-miR-708-5p
  13. Pan troglodytes ptr-miR-708
  14. Papio hamadryas pha-miR-708
  15. Pongo pygmaeus ppy-miR-708
  16. Rattus norvegicus rno-miR-708-5p
  17. Sus scrofa (pig) ssc-miR-708-5p
  18. Tupaia chinensis tch-miR-708-5p
Publications