Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-10a-5p URS000016D2D4_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-10a: Hsa-mir-10a is a microRNA that has been extensively studied in various contexts [PMC6740005]. In a study assessing the importance of different variables in model predictions, hsa-mir-10a was found to have a mean importance of 13.02 [PMC9221847]. It is part of a 3-miRNA signature (hsa-miR-20a, hsa-miR-21, hsa-mir-10a) that can stratify GBM patients and contribute to overall survival prediction [PMC9221847]. Hsa-mir-10a has also been identified as a potential biomarker for gastric cancer, showing high accuracy in discriminating different tissue types [PMC6485221]. In Drosophila, hsa-mir-10a shows overall similarity with certain human miRNAs [PMC2486268]. Hsa-mir-10a has been used as a putative non-functional control in experiments involving T-cells and primary CD4 T cells [PMC4118195]. It is one of the down-regulated miRNAs in certain cancer types, accounting for 22.9% of differentially expressed miRNAs [PMC4671457]. Hsa-mir-10a has also been studied for its target genes and its role in various pathways, such as G-Protein Signalling Modulator 1 (GPSM1) and PKDCC pathways [PMC5777794]. It is part of several gene target networks along with other miRNAs such as hsa-let-7g and hsa-miR-26b [PMC8244200]. Hsa-mir-10a has also been implicated in the prognosis and progression of certain diseases such as tuberculosis and chronic myeloid leukemia [PMC5521900] [PMC5368269]. It has been shown to have functional roles in disease progression and the regulation of gene expression [PMC7850735].

mRNA interactions 4 total

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UACCCUGUAGAUCCGAAUUUGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 34 other species

  1. Alligator mississippiensis (American alligator) ami-miR-10a-5p
  2. Anolis carolinensis aca-miR-10a-5p
  3. Ateles geoffroyi age-miR-10a
  4. Bos taurus bta-miR-10a
  5. Branchiostoma floridae (Florida lancelet) bfl-miR-10a-5p
  6. Branchiostoma lanceolatum Bla-Mir-10-P1-v2_5p (mature (guide))
  7. Callorhinchus milii Cmi-Mir-10-P1c-v1_5p (mature (guide))
  8. Capra hircus miR-10a
  9. Columba livia cli-miR-10a-5p
  10. Dasypus novemcinctus (nine-banded armadillo) dno-miR-10a-5p
  11. Eisenia fetida Efe-Mir-10-P1i_5p (mature (guide))
  12. Equus caballus eca-miR-10a
  13. Gallus gallus (chicken) Gallus_gallus piRNA piR-gga-1287
  14. Gekko japonicus Gja-Mir-10-P1c-v1_5p (mature (guide))
  15. Gorilla gorilla (western gorilla) ggo-miR-10a
  16. Hyalella azteca miR-10
  17. Macaca mulatta (Rhesus monkey) mml-miR-10a-5p
  18. Microcaecilia unicolor Mun-Mir-10-P1c-v1_5p (mature (guide))
  19. Monodelphis domestica mdo-miR-10a-5p
  20. Mus musculus (house mouse) mmu-miR-10a-5p
  21. Ophiophagus hannah oha-miR-10a-5p
  22. Ovis aries miscellaneous RNA
  23. Pan paniscus (pygmy chimpanzee) ppa-miR-10a
  24. Pan troglodytes ptr-miR-10a
  25. Pongo pygmaeus (Bornean orangutan) ppy-miR-10a
  26. Ptychodera flava Pfl-Mir-10-P1_5p (mature (guide))
  27. Python bivittatus (Burmese python) pbv-miR-10a-5p
  28. Rattus norvegicus rno-miR-10a-5p
  29. Saccoglossus kowalevskii sko-miR-10
  30. Saguinus labiatus (red-chested mustached tamarin) sla-miR-10a
  31. Scyliorhinus torazame (cloudy catshark) Sto-Mir-10-P1c-v1_5p (mature (guide))
  32. Sphenodon punctatus (tuatara) Spt-Mir-10-P1c_5p (mature (guide))
  33. Xenopus laevis Xla-Mir-10-P1c3-v1_5p (mature (guide))
  34. Xenopus tropicalis xtr-miR-10a
Publications