Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Columba livia (rock pigeon) cli-miR-10a-5p URS000016D2D4_8932

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UACCCUGUAGAUCCGAAUUUGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 34 other species

  1. Alligator mississippiensis (American alligator) ami-miR-10a-5p
  2. Anolis carolinensis aca-miR-10a-5p
  3. Ateles geoffroyi age-miR-10a
  4. Bos taurus bta-miR-10a
  5. Branchiostoma floridae bfl-miR-10a-5p
  6. Branchiostoma lanceolatum (amphioxus) Bla-Mir-10-P1-v2_5p (mature (guide))
  7. Callorhinchus milii (elephant shark) Cmi-Mir-10-P1c-v1_5p (mature (guide))
  8. Capra hircus miR-10a
  9. Dasypus novemcinctus dno-miR-10a-5p
  10. Eisenia fetida (common brandling worm) Efe-Mir-10-P1i_5p (mature (guide))
  11. Equus caballus (horse) eca-miR-10a
  12. Gallus gallus (chicken) Gallus_gallus piRNA piR-gga-1287
  13. Gekko japonicus Gja-Mir-10-P1c-v1_5p (mature (guide))
  14. Gorilla gorilla (western gorilla) ggo-miR-10a
  15. Homo sapiens hsa-miR-10a-5p
  16. Hyalella azteca miR-10
  17. Macaca mulatta (Rhesus monkey) mml-miR-10a-5p
  18. Microcaecilia unicolor Mun-Mir-10-P1c-v1_5p (mature (guide))
  19. Monodelphis domestica mdo-miR-10a-5p
  20. Mus musculus (house mouse) mmu-miR-10a-5p
  21. Ophiophagus hannah (king cobra) oha-miR-10a-5p
  22. Ovis aries miscellaneous RNA
  23. Pan paniscus (pygmy chimpanzee) ppa-miR-10a
  24. Pan troglodytes ptr-miR-10a
  25. Pongo pygmaeus ppy-miR-10a
  26. Ptychodera flava Pfl-Mir-10-P1_5p (mature (guide))
  27. Python bivittatus (Burmese python) pbv-miR-10a-5p
  28. Rattus norvegicus rno-miR-10a-5p
  29. Saccoglossus kowalevskii sko-miR-10
  30. Saguinus labiatus sla-miR-10a
  31. Scyliorhinus torazame Sto-Mir-10-P1c-v1_5p (mature (guide))
  32. Sphenodon punctatus (tuatara) Spt-Mir-10-P1c_5p (mature (guide))
  33. Xenopus laevis Xla-Mir-10-P1c3-v1_5p (mature (guide))
  34. Xenopus tropicalis (tropical clawed frog) xtr-miR-10a
Publications