Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-10a-5p URS000016D2D4_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-10a: Mmu-mir-10a is a microRNA (miRNA) that is part of a series of miRNAs, including mmu-mir-146a and mmu-mir-10b, which were investigated in a study on knockout mice [PMC3797721]. The study utilized sequencing primers to analyze the gene desert on mouse chromosome 11 and quantified the ratios of digested/undigested bands [PMC3797721]. The researchers mated two independent heterozygous mice deficient for mmu-mir-10a and -10b with wild type mice to examine the transmission of mutated alleles to the next generation [PMC3797721]. TALENs were constructed for specific gene desert regions, including mmu-mir-146a, mmu-mir-10a, and mmu-mir -10b [PMC3797721]. In a mouse leukemia model, miRNA variants of mmu-mir-10a were found to be differentially expressed across disease and normal conditions [PMC3919606]. Mmu-mir-10a is part of a paralogous sequence with mmu-miR-10b in mice [PMC4075084]. Additionally, several miRNAs including mmu-miR-761, mmu-miR-214, and mmu-miR-339 were predicted to bind four sites within 3′UTR using various tools [PMC4902921]. Overall, these findings contribute to our understanding of the role of Mmu-MIR-10a in gene regulation.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UACCCUGUAGAUCCGAAUUUGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 34 other species

  1. Alligator mississippiensis (American alligator) ami-miR-10a-5p
  2. Anolis carolinensis aca-miR-10a-5p
  3. Ateles geoffroyi age-miR-10a
  4. Bos taurus bta-miR-10a
  5. Branchiostoma floridae bfl-miR-10a-5p
  6. Branchiostoma lanceolatum (amphioxus) Bla-Mir-10-P1-v2_5p (mature (guide))
  7. Callorhinchus milii (elephant shark) Cmi-Mir-10-P1c-v1_5p (mature (guide))
  8. Capra hircus miR-10a
  9. Columba livia cli-miR-10a-5p
  10. Dasypus novemcinctus dno-miR-10a-5p
  11. Eisenia fetida (common brandling worm) Efe-Mir-10-P1i_5p (mature (guide))
  12. Equus caballus (horse) eca-miR-10a
  13. Gallus gallus (chicken) Gallus_gallus piRNA piR-gga-1287
  14. Gekko japonicus Gja-Mir-10-P1c-v1_5p (mature (guide))
  15. Gorilla gorilla (western gorilla) ggo-miR-10a
  16. Homo sapiens hsa-miR-10a-5p
  17. Hyalella azteca miR-10
  18. Macaca mulatta (Rhesus monkey) mml-miR-10a-5p
  19. Microcaecilia unicolor Mun-Mir-10-P1c-v1_5p (mature (guide))
  20. Monodelphis domestica mdo-miR-10a-5p
  21. Ophiophagus hannah (king cobra) oha-miR-10a-5p
  22. Ovis aries miscellaneous RNA
  23. Pan paniscus (pygmy chimpanzee) ppa-miR-10a
  24. Pan troglodytes ptr-miR-10a
  25. Pongo pygmaeus ppy-miR-10a
  26. Ptychodera flava Pfl-Mir-10-P1_5p (mature (guide))
  27. Python bivittatus (Burmese python) pbv-miR-10a-5p
  28. Rattus norvegicus rno-miR-10a-5p
  29. Saccoglossus kowalevskii sko-miR-10
  30. Saguinus labiatus sla-miR-10a
  31. Scyliorhinus torazame Sto-Mir-10-P1c-v1_5p (mature (guide))
  32. Sphenodon punctatus (tuatara) Spt-Mir-10-P1c_5p (mature (guide))
  33. Xenopus laevis Xla-Mir-10-P1c3-v1_5p (mature (guide))
  34. Xenopus tropicalis (tropical clawed frog) xtr-miR-10a
Publications