Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Glossina pallidipes (Tsetse fly) tRNA tRNA-Ser secondary structure diagram

Glossina pallidipes (Tsetse fly) tRNA tRNA-Ser URS000015416D_7398

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCAGUCGUGGCCGAGCGGUUAAGGCGUCUGACUAGAAAUCAGAUUCCCUCUGGGAGCGUAGGUUCGAAUCCUACCGACUGCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 102 other species

  1. Acyrthosiphon pisum (Pea aphid) tRNA-Ser
  2. Adelges cooleyi (Spruce gall adelgid) transfer RNA serine (anticodon AGA)
  3. Aedes aegypti tRNA AAEL016287
  4. Aedes albopictus (Asian tiger mosquito) tRNA tRNA-Ser
  5. Aethina tumida (Small hive beetle) transfer RNA serine (anticodon AGA)
  6. Agrilus planipennis tRNA-Ser
  7. Amyelois transitella tRNA-Ser
  8. Anopheles albimanus tRNA tRNA-Ser
  9. Anopheles arabiensis (Southern African malaria mosquito) tRNA
  10. Anopheles atroparvus tRNA
  11. Anopheles christyi tRNA tRNA-Ser
  12. Anopheles coluzzii tRNA tRNA-Ser
  13. Anopheles culicifacies tRNA tRNA-Ser
  14. Anopheles darlingi tRNA ADAC010865
  15. Anopheles dirus tRNA tRNA-Ser
  16. Anopheles epiroticus tRNA tRNA-Ser
  17. Anopheles farauti tRNA tRNA-Ser
  18. Anopheles funestus tRNA-Ser for anticodon AGA
  19. Anopheles gambiae (African malaria mosquito) tRNA tRNA-Ser
  20. Anopheles gambiae str. PEST tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 4)
  21. Anopheles maculatus tRNA tRNA-Ser
  22. Anopheles melas tRNA tRNA-Ser
  23. Anopheles merus tRNA tRNA-Ser
  24. Anopheles minimus tRNA
  25. Anopheles quadriannulatus tRNA tRNA-Ser
  26. Anopheles sinensis tRNA tRNA-Ser
  27. Anopheles stephensi tRNA tRNA-Ser
  28. Anthonomus grandis grandis (Boll weevil) transfer RNA serine (anticodon AGA)
  29. Aromia moschata tRNA-Ser
  30. Bactrocera dorsalis tRNA-Ser
  31. Bactrocera latifrons (Solanum fruit fly) tRNA-Ser
  32. Bactrocera tryoni tRNA-Ser
  33. Bicyclus anynana tRNA-Ser
  34. Blattella germanica tRNA-Ser (AGA) (tRNA-Ser-AGA-2-1)
  35. Bombyx mandarina tRNA-Ser
  36. Bombyx mori tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 8)
  37. Caligus rogercresseyi tRNA-Ser
  38. Ceratitis capitata tRNA-Ser
  39. Chelonus insularis tRNA-Ser
  40. Cinara cedri tRNA.Ser
  41. Clunio marinus tRNA
  42. Copidosoma floridanum tRNA-Ser
  43. Culex quinquefasciatus tRNA tRNA-Ser
  44. Daktulosphaira vitifoliae (Grape phylloxera) transfer RNA serine (anticodon AGA)
  45. Danaus plexippus plexippus tRNA
  46. Dendroctonus ponderosae tRNA-Ser
  47. Diuraphis noxia tRNA-Ser
  48. Drosophila ananassae tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 3)
  49. Drosophila busckii tRNA
  50. Drosophila erecta tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 5)
  51. Drosophila ficusphila tRNA
  52. Drosophila guanche tRNA.Ser
  53. Drosophila gunungcola tRNA-OTHER
  54. Drosophila melanogaster transfer RNA:Serine-AGA 2-3 (Dmel_CR31734, Dmel_CR31951, Dmel_CR32419, Dmel_CR32607, Dmel_CR32609)
  55. Drosophila mojavensis tRNA-Ser (AGA) (tRNA-Ser-AGA-1-1, tRNA-Ser-AGA-1-2)
  56. Drosophila persimilis tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 5)
  57. Drosophila pseudoobscura pseudoobscura tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 5)
  58. Drosophila sechellia tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 4)
  59. Drosophila simulans tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 4)
  60. Drosophila virilis tRNA-Ser (AGA) (tRNA-Ser-AGA-1-1)
  61. Drosophila willistoni tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 5)
  62. Drosophila yakuba tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 5)
  63. Eumeta japonica tRNA-Ser
  64. Exocentrus adspersus tRNA-Ser
  65. Galleria mellonella tRNA-Ser
  66. Glossina austeni (Tsetse fly) tRNA tRNA-Ser
  67. Glossina brevipalpis tRNA tRNA-Ser
  68. Glossina fuscipes fuscipes tRNA
  69. Glossina morsitans morsitans (Tsetse fly) tRNA tRNA-Ser
  70. Glossina palpalis gambiensis (Tsetse fly) tRNA tRNA-Ser
  71. Glyphotaelius pellucidus (Caddisflies) misc RNA ENSGPLG00000014774.1
  72. Heliconius melpomene tRNA HMEL015983
  73. Helicoverpa armigera (Cotton bollworm) transfer RNA serine (anticodon AGA)
  74. Helicoverpa zea tRNA-Ser
  75. Hermetia illucens (Black soldier fly) tRNA-Ser
  76. Leguminivora glycinivorella (Soybean pod borer) tRNA-Ser
  77. Leptinotarsa decemlineata tRNA-Ser
  78. Limnephilus lunatus (Caddisflies) misc RNA ENSLLSG00015015442.1
  79. Limnephilus marmoratus (Caddisflies) misc RNA ENSLMMG00005016315.1
  80. Limnephilus rhombicus (Caddisflies) misc RNA ENSLRHG00005016268.1
  81. Lucilia cuprina (Australian sheep blowfly) tRNA-Ser for anticodon AGA
  82. Lutzomyia longipalpis (Sand fly) tRNA tRNA-Ser
  83. Manduca sexta (Tobacco hornworm) tRNA-Ser
  84. Megaselia scalaris tRNA-Ser for anticodon AGA
  85. Melitaea cinxia misc RNA ENSMCXG00005023386.1
  86. Molorchus minor tRNA-Ser
  87. Musca domestica tRNA MDOA012738
  88. Papilio machaon tRNA
  89. Papilio xuthus tRNA
  90. Pararge aegeria tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 13)
  91. Pectinophora gossypiella transfer RNA serine (anticodon AGA)
  92. Phlebotomus papatasi tRNA tRNA-Ser
  93. Plutella xylostella (diamondback moth) tRNA-Ser
  94. Rhagoletis pomonella tRNA-Ser
  95. Rhamnusium bicolor tRNA-Ser
  96. Rhopalosiphum maidis (Corn leaf aphid) tRNA-Ser
  97. Sipha flava (Yellow sugarcane aphid) tRNA-Ser
  98. Sitophilus oryzae tRNA-Ser
  99. Spodoptera frugiperda tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 8)
  100. Stomoxys calcitrans tRNA-Ser
  101. Tribolium castaneum tRNA-Ser for anticodon AGA
  102. Zerene cesonia tRNA-Ser
2D structure Publications