v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Anopheles farauti (Mosquito) tRNA tRNA-Ser secondary structure diagram

Anopheles farauti (Mosquito) tRNA tRNA-Ser URS000015416D_69004

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCAGUCGUGGCCGAGCGGUUAAGGCGUCUGACUAGAAAUCAGAUUCCCUCUGGGAGCGUAGGUUCGAAUCCUACCGACUGCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 102 other species

  1. Acyrthosiphon pisum (Pea aphid) tRNA-Ser
  2. Adelges cooleyi (Spruce gall adelgid) transfer RNA serine (anticodon AGA)
  3. Aedes aegypti tRNA AAEL016287
  4. Aedes albopictus (Asian tiger mosquito) tRNA tRNA-Ser
  5. Aethina tumida (Small hive beetle) transfer RNA serine (anticodon AGA)
  6. Agrilus planipennis tRNA-Ser
  7. Amyelois transitella tRNA-Ser
  8. Anopheles albimanus tRNA tRNA-Ser
  9. Anopheles arabiensis (Southern African malaria mosquito) tRNA
  10. Anopheles atroparvus tRNA
  11. Anopheles christyi tRNA tRNA-Ser
  12. Anopheles coluzzii tRNA tRNA-Ser
  13. Anopheles culicifacies tRNA tRNA-Ser
  14. Anopheles darlingi tRNA ADAC010865
  15. Anopheles dirus tRNA tRNA-Ser
  16. Anopheles epiroticus tRNA tRNA-Ser
  17. Anopheles funestus tRNA-Ser for anticodon AGA
  18. Anopheles gambiae (African malaria mosquito) tRNA tRNA-Ser
  19. Anopheles gambiae str. PEST tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 4)
  20. Anopheles maculatus tRNA tRNA-Ser
  21. Anopheles melas tRNA tRNA-Ser
  22. Anopheles merus tRNA tRNA-Ser
  23. Anopheles minimus tRNA
  24. Anopheles quadriannulatus tRNA tRNA-Ser
  25. Anopheles sinensis tRNA tRNA-Ser
  26. Anopheles stephensi tRNA tRNA-Ser
  27. Anthonomus grandis grandis (Boll weevil) transfer RNA serine (anticodon AGA)
  28. Aromia moschata tRNA-Ser
  29. Bactrocera dorsalis tRNA-Ser
  30. Bactrocera latifrons (Solanum fruit fly) tRNA-Ser
  31. Bactrocera tryoni tRNA-Ser
  32. Bicyclus anynana tRNA-Ser
  33. Blattella germanica tRNA-Ser (AGA) (tRNA-Ser-AGA-2-1)
  34. Bombyx mandarina tRNA-Ser
  35. Bombyx mori tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 8)
  36. Caligus rogercresseyi tRNA-Ser
  37. Ceratitis capitata tRNA-Ser
  38. Chelonus insularis tRNA-Ser
  39. Cinara cedri tRNA.Ser
  40. Clunio marinus tRNA
  41. Copidosoma floridanum tRNA-Ser
  42. Culex quinquefasciatus tRNA tRNA-Ser
  43. Daktulosphaira vitifoliae (Grape phylloxera) transfer RNA serine (anticodon AGA)
  44. Danaus plexippus plexippus tRNA
  45. Dendroctonus ponderosae tRNA-Ser
  46. Diuraphis noxia tRNA-Ser
  47. Drosophila ananassae tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 3)
  48. Drosophila busckii tRNA
  49. Drosophila erecta tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 5)
  50. Drosophila ficusphila tRNA
  51. Drosophila guanche tRNA.Ser
  52. Drosophila gunungcola tRNA-OTHER
  53. Drosophila melanogaster transfer RNA:Serine-AGA 2-3 (Dmel_CR31734, Dmel_CR31951, Dmel_CR32419, Dmel_CR32607, Dmel_CR32609)
  54. Drosophila mojavensis tRNA-Ser (AGA) (tRNA-Ser-AGA-1-1, tRNA-Ser-AGA-1-2)
  55. Drosophila persimilis tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 5)
  56. Drosophila pseudoobscura pseudoobscura tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 5)
  57. Drosophila sechellia tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 4)
  58. Drosophila simulans tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 4)
  59. Drosophila virilis tRNA-Ser (AGA) (tRNA-Ser-AGA-1-1)
  60. Drosophila willistoni tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 5)
  61. Drosophila yakuba tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 5)
  62. Eumeta japonica tRNA-Ser
  63. Exocentrus adspersus tRNA-Ser
  64. Galleria mellonella tRNA-Ser
  65. Glossina austeni (Tsetse fly) tRNA tRNA-Ser
  66. Glossina brevipalpis tRNA tRNA-Ser
  67. Glossina fuscipes fuscipes tRNA
  68. Glossina morsitans morsitans (Tsetse fly) tRNA tRNA-Ser
  69. Glossina pallidipes (Tsetse fly) tRNA tRNA-Ser
  70. Glossina palpalis gambiensis (Tsetse fly) tRNA tRNA-Ser
  71. Glyphotaelius pellucidus (Caddisflies) misc RNA ENSGPLG00000014774.1
  72. Heliconius melpomene tRNA HMEL015983
  73. Helicoverpa armigera (Cotton bollworm) transfer RNA serine (anticodon AGA)
  74. Helicoverpa zea tRNA-Ser
  75. Hermetia illucens (Black soldier fly) tRNA-Ser
  76. Leguminivora glycinivorella (Soybean pod borer) tRNA-Ser
  77. Leptinotarsa decemlineata tRNA-Ser
  78. Limnephilus lunatus (Caddisflies) misc RNA ENSLLSG00015015442.1
  79. Limnephilus marmoratus (Caddisflies) misc RNA ENSLMMG00005016315.1
  80. Limnephilus rhombicus (Caddisflies) misc RNA ENSLRHG00005016268.1
  81. Lucilia cuprina (Australian sheep blowfly) tRNA-Ser for anticodon AGA
  82. Lutzomyia longipalpis (Sand fly) tRNA tRNA-Ser
  83. Manduca sexta (Tobacco hornworm) tRNA-Ser
  84. Megaselia scalaris tRNA-Ser for anticodon AGA
  85. Melitaea cinxia misc RNA ENSMCXG00005023386.1
  86. Molorchus minor tRNA-Ser
  87. Musca domestica tRNA MDOA012738
  88. Papilio machaon tRNA
  89. Papilio xuthus tRNA
  90. Pararge aegeria tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 13)
  91. Pectinophora gossypiella transfer RNA serine (anticodon AGA)
  92. Phlebotomus papatasi tRNA tRNA-Ser
  93. Plutella xylostella (diamondback moth) tRNA-Ser
  94. Rhagoletis pomonella tRNA-Ser
  95. Rhamnusium bicolor tRNA-Ser
  96. Rhopalosiphum maidis (Corn leaf aphid) tRNA-Ser
  97. Sipha flava (Yellow sugarcane aphid) tRNA-Ser
  98. Sitophilus oryzae tRNA-Ser
  99. Spodoptera frugiperda tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 8)
  100. Stomoxys calcitrans tRNA-Ser
  101. Tribolium castaneum tRNA-Ser for anticodon AGA
  102. Zerene cesonia tRNA-Ser
 2D structure Publications