v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Glyphotaelius pellucidus (Caddisflies) misc RNA ENSGPLG00000014774.1 secondary structure diagram

Glyphotaelius pellucidus (Caddisflies) misc RNA ENSGPLG00000014774.1 URS000015416D_1271742

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCAGUCGUGGCCGAGCGGUUAAGGCGUCUGACUAGAAAUCAGAUUCCCUCUGGGAGCGUAGGUUCGAAUCCUACCGACUGCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 186 other species

  1. Acyrthosiphon pisum (Pea aphid) tRNA-Ser
  2. Adelges cooleyi (Spruce gall adelgid) transfer RNA serine (anticodon AGA)
  3. Aedes aegypti tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 17)
  4. Aedes albopictus tRNA tRNA-Ser
  5. Aethina tumida (Small hive beetle) transfer RNA serine (anticodon AGA)
  6. Agrilus planipennis (Emerald ash borer) tRNA-Ser
  7. Amyelois transitella (Moths) transfer RNA serine (anticodon AGA)
  8. Anastrepha ludens (Mexican fruit fly) transfer RNA serine (anticodon AGA)
  9. Anastrepha obliqua (WestIndian fruit fly) transfer RNA serine (anticodon AGA)
  10. Anopheles albimanus (Mosquitos) tRNA-Ser
  11. Anopheles arabiensis tRNA
  12. Anopheles atroparvus tRNA
  13. Anopheles christyi (Mosquito) tRNA tRNA-Ser
  14. Anopheles coluzzii tRNA tRNA-Ser
  15. Anopheles culicifacies tRNA tRNA-Ser
  16. Anopheles darlingi (American malaria mosquito) tRNA ADAC010865
  17. Anopheles dirus (Mosquito) tRNA tRNA-Ser
  18. Anopheles epiroticus (Mosquito) tRNA tRNA-Ser
  19. Anopheles farauti tRNA tRNA-Ser
  20. Anopheles funestus tRNA-Ser for anticodon AGA
  21. Anopheles gambiae tRNA tRNA-Ser
  22. Anopheles gambiae str. PEST tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 4)
  23. Anopheles maculatus tRNA tRNA-Ser
  24. Anopheles melas tRNA tRNA-Ser
  25. Anopheles merus (Mosquito) tRNA tRNA-Ser
  26. Anopheles minimus tRNA
  27. Anopheles quadriannulatus tRNA tRNA-Ser
  28. Anopheles sinensis tRNA tRNA-Ser
  29. Anopheles stephensi (Asian malaria mosquito) tRNA tRNA-Ser
  30. Anoplophora glabripennis (Asian long-horned beetle) tRNA-Ser
  31. Anthonomus grandis grandis (Boll weevil) transfer RNA serine (anticodon AGA)
  32. Aphis craccivora (cowpea aphid) tRNA
  33. Aphis glycines (soybean aphid) tRNA
  34. Aphis gossypii (cotton aphid) tRNA
  35. Aromia moschata tRNA-Ser
  36. Asbolus verrucosus (desert ironclad beetle) tRNA
  37. Bactrocera dorsalis transfer RNA serine (anticodon AGA)
  38. Bactrocera latifrons tRNA-Ser
  39. Bactrocera neohumeralis (Lesser Queensland fruit fly) transfer RNA serine (anticodon AGA)
  40. Bactrocera oleae (Olive fruit fly) tRNA-Ser
  41. Bactrocera tryoni tRNA-Ser
  42. Bicyclus anynana (squinting bush brown) misc RNA ENSINYG00000026283.1
  43. Blattella germanica tRNA-Ser (AGA) (tRNA-Ser-AGA-2-1)
  44. Bombyx mandarina (Wild silkworm) tRNA-Ser
  45. Bombyx mori tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 8)
  46. Brassicogethes aeneus (rape pollen beetle) tRNA
  47. Brenthis ino (lesser marbled fritillary) tRNA
  48. Caligus rogercresseyi tRNA
  49. Ceratitis capitata (Mediterranean fruit fly) tRNA-Ser
  50. Ceutorhynchus assimilis (cabbage seed weevil) tRNA
  51. Chelonus insularis tRNA-Ser
  52. Chrysodeixis includens tRNA
  53. Chrysoperla carnea (Green lacewing) tRNA-Ser
  54. Cinara cedri tRNA
  55. Clunio marinus tRNA
  56. Copidosoma floridanum tRNA-Ser
  57. Coremacera marginata (Sieve-winged Snailkiller) misc RNA ENSCNRG00005015392.1
  58. Cryptolaemus montrouzieri tRNA-Ser
  59. Ctenocephalides felis (Cat flea) tRNA-Ser
  60. Culex pipiens pallens (Northern house mosquito) transfer RNA serine (anticodon AGA)
  61. Culex quinquefasciatus tRNA
  62. Culicoides brevitarsis (Biting midge) transfer RNA serine (anticodon AGA)
  63. Cydia pomonella (The codling moth) transfer RNA serine (anticodon AGA)
  64. Cylas formicarius (Sweet potato weevil) transfer RNA serine (anticodon AGA)
  65. Daktulosphaira vitifoliae (Grape phylloxera) transfer RNA serine (anticodon AGA)
  66. Danaus chrysippus (African queen) tRNA
  67. Danaus plexippus (monarch butterfly) misc RNA ENSDPXG00000018359.1
  68. Danaus plexippus plexippus (Monarch butterfly) tRNA-Ser
  69. Dendroctonus ponderosae (Mountain pine beetle) tRNA-Ser
  70. Diatraea saccharalis (sugarcane borer) tRNA
  71. Diuraphis noxia tRNA-Ser
  72. Drosophila albomicans (Fruit fly) transfer RNA serine (anticodon AGA)
  73. Drosophila ananassae tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 3)
  74. Drosophila arizonae (Fruit fly) tRNA-Ser
  75. Drosophila biarmipes (Fruit fly) transfer RNA serine (anticodon AGA)
  76. Drosophila bipectinata (Pomace flies) transfer RNA serine (anticodon AGA)
  77. Drosophila busckii (Fruit fly) tRNA-Ser
  78. Drosophila elegans (Pomace flies) tRNA-Ser
  79. Drosophila erecta tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 5)
  80. Drosophila eugracilis (Fruit fly) tRNA-Ser
  81. Drosophila ficusphila (Fruit fly) tRNA-Ser
  82. Drosophila guanche (Fruit fly) tRNA-Ser
  83. Drosophila gunungcola (Fruit fly) transfer RNA serine (anticodon AGA)
  84. Drosophila hydei (Fruit fly) tRNA-Ser
  85. Drosophila innubila (Fruit fly) tRNA-Ser
  86. Drosophila kikkawai (Pomace flies) transfer RNA serine (anticodon AGA)
  87. Drosophila mauritiana (Fruit fly) tRNA-Ser
  88. Drosophila melanogaster transfer RNA:Serine-AGA 2-3 (Dmel_CR31734, Dmel_CR31951, Dmel_CR32419, Dmel_CR32607, Dmel_CR32609)
  89. Drosophila miranda (Fruit fly) tRNA-Ser
  90. Drosophila mojavensis tRNA-Ser (AGA) (tRNA-Ser-AGA-1-1, tRNA-Ser-AGA-1-2)
  91. Drosophila montana (Pomace flies) transfer RNA serine (anticodon AGA)
  92. Drosophila nasuta (Pomace flies) transfer RNA serine (anticodon AGA)
  93. Drosophila navojoa (Fruit fly) tRNA-Ser
  94. Drosophila novamexicana (Pomace flies) tRNA-Ser
  95. Drosophila obscura (Fruit fly) tRNA-Ser
  96. Drosophila persimilis tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 5)
  97. Drosophila pseudoobscura (Fruit fly) tRNA-Ser
  98. Drosophila pseudoobscura pseudoobscura tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 5)
  99. Drosophila rhopaloa (Fruit fly) tRNA-Ser
  100. Drosophila santomea (Fruit fly) tRNA-Ser
  101. Drosophila sechellia tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 4)
  102. Drosophila serrata (Pomace flies) tRNA-Ser
  103. Drosophila simulans tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 4)
  104. Drosophila subobscura (Fruit fly) tRNA-Ser
  105. Drosophila subpulchrella (Fruit fly) tRNA-Ser
  106. Drosophila sulfurigaster albostrigata (Flies) transfer RNA serine (anticodon AGA)
  107. Drosophila suzukii (Pomace flies) transfer RNA serine (anticodon AGA)
  108. Drosophila takahashii (Pomace flies) transfer RNA serine (anticodon AGA)
  109. Drosophila teissieri (Fruit fly) tRNA-Ser
  110. Drosophila tropicalis (Pomace flies) transfer RNA serine (anticodon AGA)
  111. Drosophila virilis tRNA-Ser (AGA) (tRNA-Ser-AGA-1-1)
  112. Drosophila willistoni tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 5)
  113. Drosophila yakuba tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 5)
  114. Eumeta japonica tRNA
  115. Exocentrus adspersus tRNA-Ser
  116. Galleria mellonella (greater wax moth) tRNA
  117. Glossina austeni (Tsetse fly) tRNA tRNA-Ser
  118. Glossina brevipalpis tRNA tRNA-Ser
  119. Glossina fuscipes fuscipes tRNA
  120. Glossina fuscipes (Tsetse fly) tRNA-Ser
  121. Glossina morsitans morsitans (Tsetse fly) tRNA tRNA-Ser
  122. Glossina pallidipes (Tsetse fly) tRNA tRNA-Ser
  123. Glossina palpalis gambiensis (Tsetse fly) tRNA tRNA-Ser
  124. Heliconius melpomene (Postman butterfly) tRNA HMEL015983
  125. Helicoverpa armigera transfer RNA serine (anticodon AGA)
  126. Helicoverpa zea tRNA-Ser
  127. Heliothis virescens (tobacco budworm) tRNA
  128. Henosepilachna vigintioctopunctata tRNA-Ser
  129. Hermetia illucens (Black soldier fly) tRNA-Ser
  130. Hypothenemus hampei tRNA-Ser
  131. Ignelater luminosus (cucubano) tRNA
  132. Ladona fulva tRNA
  133. Leguminivora glycinivorella (Soybean pod borer) tRNA-Ser
  134. Leptidea sinapis tRNA
  135. Leptinotarsa decemlineata tRNA-Ser
  136. Limnephilus lunatus (Caddisflies) misc RNA ENSLLSG00015015442.1
  137. Limnephilus marmoratus (Caddisflies) misc RNA ENSLMMG00005016315.1
  138. Limnephilus rhombicus (Caddisflies) misc RNA ENSLRHG00005016268.1
  139. Lucilia cuprina tRNA-Ser for anticodon AGA
  140. Lucilia sericata (Common green bottle fly) tRNA-Ser
  141. Lutzomyia longipalpis tRNA tRNA-Ser
  142. Machimus atricapillus (Kite-tailed Robberfly) misc RNA ENSAMHG00005011452.1
  143. Malaya genurostris (Mosquitos) transfer RNA serine (anticodon AGA)
  144. Manduca sexta tRNA-Ser
  145. Megaselia scalaris tRNA-Ser for anticodon AGA
  146. Melanaphis sacchari (Sugarcane aphid) tRNA-Ser
  147. Melitaea cinxia misc RNA ENSMCXG00005023386.1
  148. Molorchus minor tRNA-Ser
  149. Musca domestica (House fly) transfer RNA serine (anticodon AGA)
  150. Myopa tessellatipennis (flies) misc RNA ENSMTEG00005013496.1
  151. Papilio machaon tRNA
  152. Papilio xuthus tRNA
  153. Pararge aegeria aegeria tRNA
  154. Pararge aegeria tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 13)
  155. Arctia plantaginis Parasemia plantaginis tRNA
  156. Parnassius apollo (apollo) tRNA
  157. Pectinophora gossypiella transfer RNA serine (anticodon AGA)
  158. Phaedon cochleariae (mustard beetle) tRNA
  159. Phlebotomus argentipes (Sand fly) transfer RNA serine (anticodon AGA)
  160. Phlebotomus papatasi tRNA tRNA-Ser
  161. Photinus pyralis (Common eastern firefly) tRNA-Ser
  162. Phthorimaea operculella tRNA-Ser
  163. Pieris brassicae (large cabbage white) tRNA
  164. Pieris macdunnoughi tRNA
  165. Plodia interpunctella (Indianmeal moth) transfer RNA serine (anticodon AGA)
  166. Plutella xylostella tRNA
  167. Rhagoletis pomonella tRNA-Ser
  168. Rhamnusium bicolor tRNA-Ser
  169. Rhopalosiphum maidis tRNA-Ser
  170. Rhynchophorus ferrugineus (red palm weevil) tRNA
  171. Scaptodrosophila lebanonensis tRNA
  172. Sergentomyia squamirostris tRNA-Ser
  173. Sipha flava tRNA-Ser
  174. Sitophilus oryzae tRNA-Ser
  175. Spodoptera exigua (beet armyworm) tRNA
  176. Spodoptera frugiperda tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 8)
  177. Spodoptera littoralis tRNA
  178. Spodoptera litura tRNA
  179. Stomoxys calcitrans (stable fly) transfer RNA serine (anticodon AGA)
  180. Teleopsis dalmanni (Malaysian stalk-eyed fly) tRNA-Ser
  181. Tenebrio molitor (yellow mealworm) tRNA
  182. Topomyia yanbarensis (Mosquitos) transfer RNA serine (anticodon AGA)
  183. Toxorhynchites rutilus septentrionalis (Elephant mosquito) transfer RNA serine (anticodon AGA)
  184. Tribolium castaneum transfer RNA serine (anticodon AGA)
  185. Tribolium madens (Black flour beetle) tRNA-Ser
  186. Trichoplusia ni (cabbage looper) tRNA
  187. Uranotaenia lowii (Mosquitos) transfer RNA serine (anticodon AGA)
  188. Vanessa tameamea tRNA
  189. Wyeomyia smithii (Pitcher plant Mosquito) transfer RNA serine (anticodon AGA)
  190. Zerene cesonia tRNA-Ser
  191. Zeugodacus cucurbitae (Melon fly) transfer RNA serine (anticodon AGA)
  192. Zophobas morio tRNA
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...