Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Danaus plexippus plexippus tRNA secondary structure diagram

Danaus plexippus plexippus tRNA URS000015416D_278856

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCAGUCGUGGCCGAGCGGUUAAGGCGUCUGACUAGAAAUCAGAUUCCCUCUGGGAGCGUAGGUUCGAAUCCUACCGACUGCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 172 other species

  1. Acyrthosiphon pisum tRNA-Ser
  2. Adelges cooleyi (Spruce gall adelgid) transfer RNA serine (anticodon AGA)
  3. Aedes aegypti tRNA AAEL016287
  4. Aedes albopictus tRNA tRNA-Ser
  5. Aethina tumida (Small hive beetle) transfer RNA serine (anticodon AGA)
  6. Agrilus planipennis (Emerald ash borer) tRNA-Ser
  7. Amyelois transitella tRNA-Ser
  8. Anastrepha ludens (Mexican fruit fly) transfer RNA serine (anticodon AGA)
  9. Anastrepha obliqua (WestIndian fruit fly) transfer RNA serine (anticodon AGA)
  10. Anopheles albimanus tRNA tRNA-Ser
  11. Anopheles arabiensis tRNA
  12. Anopheles atroparvus tRNA
  13. Anopheles christyi (Mosquito) tRNA tRNA-Ser
  14. Anopheles coluzzii tRNA tRNA-Ser
  15. Anopheles culicifacies (Mosquito) tRNA tRNA-Ser
  16. Anopheles darlingi tRNA ADAC010865
  17. Anopheles dirus tRNA tRNA-Ser
  18. Anopheles epiroticus (Mosquito) tRNA tRNA-Ser
  19. Anopheles farauti tRNA tRNA-Ser
  20. Anopheles funestus tRNA-Ser for anticodon AGA
  21. Anopheles gambiae tRNA tRNA-Ser
  22. Anopheles gambiae str. PEST tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 4)
  23. Anopheles maculatus tRNA tRNA-Ser
  24. Anopheles melas tRNA tRNA-Ser
  25. Anopheles merus tRNA tRNA-Ser
  26. Anopheles minimus tRNA
  27. Anopheles quadriannulatus tRNA tRNA-Ser
  28. Anopheles sinensis tRNA tRNA-Ser
  29. Anopheles stephensi tRNA tRNA-Ser
  30. Anthonomus grandis grandis transfer RNA serine (anticodon AGA)
  31. Aphis craccivora (cowpea aphid) tRNA
  32. Aphis glycines (soybean aphid) tRNA
  33. Aphis gossypii (cotton aphid) tRNA
  34. Aromia moschata tRNA-Ser
  35. Asbolus verrucosus (desert ironclad beetle) tRNA
  36. Bactrocera dorsalis (Oriental fruit fly) tRNA-Ser
  37. Bactrocera latifrons (Solanum fruit fly) tRNA-Ser
  38. Bactrocera neohumeralis (Lesser Queensland fruit fly) transfer RNA serine (anticodon AGA)
  39. Bactrocera tryoni (Queensland fruitfly) tRNA-Ser
  40. Bicyclus anynana tRNA-Ser
  41. Blattella germanica tRNA-Ser (AGA) (tRNA-Ser-AGA-2-1)
  42. Bombyx mandarina tRNA-Ser
  43. Bombyx mori tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 8)
  44. Brassicogethes aeneus (rape pollen beetle) tRNA
  45. Brenthis ino (lesser marbled fritillary) tRNA
  46. Caligus rogercresseyi tRNA
  47. Ceratitis capitata tRNA-Ser
  48. Ceutorhynchus assimilis (cabbage seed weevil) tRNA
  49. Chelonus insularis tRNA-Ser
  50. Chrysodeixis includens tRNA
  51. Cinara cedri tRNA
  52. Clunio marinus tRNA
  53. Copidosoma floridanum tRNA-Ser
  54. Coremacera marginata (Sieve-winged Snailkiller) misc RNA ENSCNRG00005015392.1
  55. Cryptolaemus montrouzieri tRNA-Ser
  56. Ctenocephalides felis (Cat flea) tRNA-Ser
  57. Culex pipiens pallens (Northern house mosquito) transfer RNA serine (anticodon AGA)
  58. Culex quinquefasciatus tRNA tRNA-Ser
  59. Cylas formicarius (Sweet potato weevil) transfer RNA serine (anticodon AGA)
  60. Daktulosphaira vitifoliae (Grape phylloxera) transfer RNA serine (anticodon AGA)
  61. Danaus chrysippus (African queen) tRNA
  62. Dendroctonus ponderosae (Mountain pine beetle) tRNA-Ser
  63. Diatraea saccharalis (sugarcane borer) tRNA
  64. Diuraphis noxia tRNA-Ser
  65. Drosophila albomicans (Fruit fly) transfer RNA serine (anticodon AGA)
  66. Drosophila ananassae tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 3)
  67. Drosophila arizonae (Fruit fly) tRNA-Ser
  68. Drosophila biarmipes (Fruit fly) transfer RNA serine (anticodon AGA)
  69. Drosophila bipectinata (Fruit fly) tRNA-Ser
  70. Drosophila busckii (Fruit fly) tRNA-Ser
  71. Drosophila elegans (Fruit fly) tRNA-Ser
  72. Drosophila erecta tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 5)
  73. Drosophila eugracilis (Fruit fly) tRNA-Ser
  74. Drosophila ficusphila (Fruit fly) tRNA-Ser
  75. Drosophila guanche (Fruit fly) tRNA-Ser
  76. Drosophila gunungcola (Fruit fly) transfer RNA serine (anticodon AGA)
  77. Drosophila hydei (Fruit fly) tRNA-Ser
  78. Drosophila innubila (Fruit fly) tRNA-Ser
  79. Drosophila kikkawai (Fruit fly) tRNA-Ser
  80. Drosophila mauritiana (Fruit fly) tRNA-Ser
  81. Drosophila melanogaster transfer RNA:Serine-AGA 2-3 (Dmel_CR31734, Dmel_CR31951, Dmel_CR32419, Dmel_CR32607, Dmel_CR32609)
  82. Drosophila miranda (Fruit fly) tRNA-Ser
  83. Drosophila mojavensis tRNA-Ser (AGA) (tRNA-Ser-AGA-1-1, tRNA-Ser-AGA-1-2)
  84. Drosophila navojoa (Fruit fly) tRNA-Ser
  85. Drosophila obscura (Fruit fly) tRNA-Ser
  86. Drosophila persimilis tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 5)
  87. Drosophila pseudoobscura (Fruit fly) tRNA-Ser
  88. Drosophila pseudoobscura pseudoobscura tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 5)
  89. Drosophila rhopaloa (Fruit fly) tRNA-Ser
  90. Drosophila santomea (Fruit fly) tRNA-Ser
  91. Drosophila sechellia tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 4)
  92. Drosophila simulans tRNA-Ser (AGA) (tRNA-Ser-AGA-2 1 to 4)
  93. Drosophila subobscura (Fruit fly) tRNA-Ser
  94. Drosophila subpulchrella (Fruit fly) tRNA-Ser
  95. Drosophila suzukii (Fruit fly) tRNA-Ser
  96. Drosophila takahashii (Fruit fly) tRNA-Ser
  97. Drosophila teissieri (Fruit fly) tRNA-Ser
  98. Drosophila virilis tRNA-Ser (AGA) (tRNA-Ser-AGA-1-1)
  99. Drosophila willistoni tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 5)
  100. Drosophila yakuba tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 5)
  101. Eumeta japonica tRNA
  102. Exocentrus adspersus tRNA-Ser
  103. Galleria mellonella tRNA-Ser
  104. Glossina austeni tRNA tRNA-Ser
  105. Glossina brevipalpis tRNA tRNA-Ser
  106. Glossina fuscipes fuscipes tRNA
  107. Glossina morsitans morsitans tRNA tRNA-Ser
  108. Glossina pallidipes (Tsetse fly) tRNA tRNA-Ser
  109. Glossina palpalis gambiensis (Tsetse fly) tRNA tRNA-Ser
  110. Glyphotaelius pellucidus (Caddisflies) misc RNA ENSGPLG00000014774.1
  111. Heliconius melpomene tRNA HMEL015983
  112. Helicoverpa armigera (Cotton bollworm) transfer RNA serine (anticodon AGA)
  113. Helicoverpa zea (Corn earworm) tRNA-Ser
  114. Heliothis virescens (tobacco budworm) tRNA
  115. Henosepilachna vigintioctopunctata tRNA-Ser
  116. Hermetia illucens tRNA-Ser
  117. Hypothenemus hampei tRNA-Ser
  118. Ignelater luminosus (cucubano) tRNA
  119. Ladona fulva tRNA
  120. Leguminivora glycinivorella tRNA-Ser
  121. Leptidea sinapis tRNA
  122. Leptinotarsa decemlineata (Colorado potato beetle) tRNA-Ser
  123. Limnephilus lunatus (Caddisflies) misc RNA ENSLLSG00015015442.1
  124. Limnephilus marmoratus (Caddisflies) misc RNA ENSLMMG00005016315.1
  125. Limnephilus rhombicus (Caddisflies) misc RNA ENSLRHG00005016268.1
  126. Lucilia cuprina tRNA-Ser for anticodon AGA
  127. Lutzomyia longipalpis (Sand fly) tRNA tRNA-Ser
  128. Machimus atricapillus (Kite-tailed Robberfly) misc RNA ENSAMHG00005011452.1
  129. Malaya genurostris (Mosquitos) transfer RNA serine (anticodon AGA)
  130. Manduca sexta tRNA-Ser
  131. Megaselia scalaris tRNA-Ser for anticodon AGA
  132. Melanaphis sacchari (Sugarcane aphid) tRNA-Ser
  133. Melitaea cinxia misc RNA ENSMCXG00005023386.1
  134. Molorchus minor tRNA-Ser
  135. Musca domestica (House fly) tRNA MDOA012738
  136. Myopa tessellatipennis (Thick-headed flies) misc RNA ENSMTEG00005013070.1
  137. Papilio machaon tRNA
  138. Papilio xuthus tRNA
  139. Pararge aegeria aegeria tRNA
  140. Pararge aegeria tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 13)
  141. Arctia plantaginis Parasemia plantaginis tRNA
  142. Parnassius apollo (apollo) tRNA
  143. Pectinophora gossypiella transfer RNA serine (anticodon AGA)
  144. Phaedon cochleariae (mustard beetle) tRNA
  145. Phlebotomus argentipes (Sand fly) transfer RNA serine (anticodon AGA)
  146. Phlebotomus papatasi (Sand fly) tRNA tRNA-Ser
  147. Photinus pyralis (common eastern firefly) tRNA
  148. Pieris brassicae (large cabbage white) tRNA
  149. Pieris macdunnoughi tRNA
  150. Plodia interpunctella (Indianmeal moth) transfer RNA serine (anticodon AGA)
  151. Plutella xylostella tRNA
  152. Rhagoletis pomonella (Apple magot fly) tRNA-Ser
  153. Rhamnusium bicolor tRNA-Ser
  154. Rhopalosiphum maidis (Corn leaf aphid) tRNA-Ser
  155. Rhynchophorus ferrugineus (red palm weevil) tRNA
  156. Scaptodrosophila lebanonensis tRNA
  157. Sergentomyia squamirostris tRNA-Ser
  158. Sipha flava (Yellow sugarcane aphid) tRNA-Ser
  159. Sitophilus oryzae tRNA-Ser
  160. Spodoptera exigua (beet armyworm) tRNA
  161. Spodoptera frugiperda tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 8)
  162. Spodoptera littoralis tRNA
  163. Spodoptera litura tRNA
  164. Stomoxys calcitrans (Stable fly) tRNA-Ser
  165. Tenebrio molitor (yellow mealworm) tRNA
  166. Topomyia yanbarensis (Mosquitos) transfer RNA serine (anticodon AGA)
  167. Toxorhynchites rutilus septentrionalis (Elephant mosquito) transfer RNA serine (anticodon AGA)
  168. Tribolium castaneum tRNA-Ser for anticodon AGA
  169. Tribolium madens (Black flour beetle) tRNA-Ser
  170. Trichoplusia ni (cabbage looper) tRNA
  171. Uranotaenia lowii (Mosquitos) transfer RNA serine (anticodon AGA)
  172. Vanessa tameamea tRNA
  173. Wyeomyia smithii (Pitcher plant Mosquito) transfer RNA serine (anticodon AGA)
  174. Zerene cesonia (Southern Dogface) tRNA-Ser
  175. Zeugodacus cucurbitae (Melon fly) transfer RNA serine (anticodon AGA)
  176. Zophobas morio tRNA
Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Publications