Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) RNA, 5S ribosomal 1 (RNA5S1-8, RNA5S10-17) secondary structure diagram

Homo sapiens (human) RNA, 5S ribosomal 1 (RNA5S1-8, RNA5S10-17) URS00000F9D45_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

RNA5S5: The RNA5S5 gene, transcribed by RNA polymerase III (Pol III), is a representative 5S ribosomal RNA gene that is 121 nucleotides long [1]. It is encoded by rDNA RNA5S5 on Chromosome 1 in humans [2]. In studies, rRNA presence was determined by mapping reads to rRNA human sequences, including RNA28S5, RNA18S5, RNA5-8S5, and RNA5S57 [3]. GenBank sequences of rRNAs (45SN1, 16SN2, MT-RNR1) were used as reference sequences for analysis [1]. In gene expression analysis, the CCL2 gene showed the greatest decrease in expression, followed by CIC and several ribosomal RNA genes or pseudogenes, including RNA5S5 [4]. G4-L1 motifs were found in the promoter of the RNA-8SN gene and in genes such as RNA28SN2 [5]. The example gene used for UCSC genome browser display was RNA5S57 [6]. In another study on dysregulated peak-associated genes, Homo sapiens RNA was found to be dysregulated in LS group samples [7].

mRNA interactions 2 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUCUACGGCCAUACCACCCUGAACGCGCCCGAUCUCGUCUGAUCUCGGAAGCUAAGCAGGGUCGGGCCUGGUUAGUACUUGGAUGGGAGACCGCCUGGGAAUACCGGGUGCUGUAGGCUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

2D structure Publications