Macaca fascicularis (crab-eating macaque) 5S ribosomal RNA

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Macaca fascicularis (crab-eating macaque) 5S ribosomal RNA URS00000F9D45_9541

121 nucleotides
1 database (ENA)
Found in 7 other species

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

GUCUACGGCCAUACCACCCUGAACGCGCCCGAUCUCGUCUGAUCUCGGAAGCUAAGCAGGGUCGGGCCUGGUUAGUACUUGGAUGGGAGACCGCCUGGGAAUACCGGGUGCUGUAGGCUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

Mus musculus 5S ribosomal RNA from Mus musculus (PDB 7LS1, chain B2)
Oryctolagus cuniculus 5S ribosomal RNA from Oryctolagus cuniculus (PDB 4D67, chain 4)
Cavia porcellus 5S ribosomal RNA (LOC100379618)
Homo sapiens (human) RNA, 5S ribosomal 1 (RNA5S1-8, RNA5S10-17)
Mesocricetus auratus rRNA
Rattus norvegicus RNA (121-MER) from Rattus norvegicus (PDB 7QGG, chain E)
Tursiops truncatus 5S ribosomal RNA

2D structure