v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
RNA (121-MER) from Rattus norvegicus (PDB 7QGG, chain E) secondary structure diagram

RNA (121-MER) from Rattus norvegicus (PDB 7QGG, chain E) URS00000F9D45_10116

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GUCUACGGCCAUACCACCCUGAACGCGCCCGAUCUCGUCUGAUCUCGGAAGCUAAGCAGGGUCGGGCCUGGUUAGUACUUGGAUGGGAGACCGCCUGGGAAUACCGGGUGCUGUAGGCUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

  1. Mus musculus 5S ribosomal RNA from Mus musculus (PDB 7LS1, chain B2)
  2. Oryctolagus cuniculus 5S ribosomal RNA from Oryctolagus cuniculus (PDB 4D67, chain 4)
  3. Cavia porcellus 5S ribosomal RNA (LOC100379618)
  4. Homo sapiens (human) RNA, 5S ribosomal 1 (RNA5S1-8, RNA5S10-17)
  5. Macaca fascicularis 5S ribosomal RNA
  6. Mesocricetus auratus rRNA
  7. Tursiops truncatus 5S ribosomal RNA
 2D structure